Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403254268:

Variant ID: vg0403254268 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3254268
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTCATCGCAACTAGTCCTCCACAATATTCATCCCGATGCCATTGCCCCACCGGGCGTTCCCAAGCTTCTTCGTCGCGGGCTGCTGGTCGTCTGCAAGAT[T/C]
TGTGGATGACATTGTTCGTCCACGAGCTTCATTGCCACAGTCAGGCCACCACAATCTTCGTAGTCAAACTGTTACGCCACCAGACATCCAAGAGTTTCTT

Reverse complement sequence

AAGAAACTCTTGGATGTCTGGTGGCGTAACAGTTTGACTACGAAGATTGTGGTGGCCTGACTGTGGCAATGAAGCTCGTGGACGAACAATGTCATCCACA[A/G]
ATCTTGCAGACGACCAGCAGCCCGCGACGAAGAAGCTTGGGAACGCCCGGTGGGGCAATGGCATCGGGATGAATATTGTGGAGGACTAGTTGCGATGAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	7.00%	0.44%	3.30%	NA
All Indica	2759	95.60%	0.80%	0.25%	3.37%	NA
All Japonica	1512	83.80%	11.50%	0.86%	3.84%	NA
Aus	269	51.70%	46.80%	0.37%	1.12%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	0.00%	0.00%	1.08%	NA
Indica III	913	90.90%	1.40%	0.44%	7.23%	NA
Indica Intermediate	786	95.80%	1.00%	0.38%	2.80%	NA
Temperate Japonica	767	78.20%	19.00%	1.43%	1.30%	NA
Tropical Japonica	504	93.70%	3.40%	0.20%	2.78%	NA
Japonica Intermediate	241	80.90%	4.60%	0.41%	14.11%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	93.30%	4.40%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403254268	T -> C	LOC_Os04g06260.1	upstream_gene_variant ; 3533.0bp to feature; MODIFIER	silent_mutation	Average:54.197; most accessible tissue: Zhenshan97 young leaf, score: 90.175	N	N	N	N
vg0403254268	T -> C	LOC_Os04g06244-LOC_Os04g06260	intergenic_region ; MODIFIER	silent_mutation	Average:54.197; most accessible tissue: Zhenshan97 young leaf, score: 90.175	N	N	N	N
vg0403254268	T -> DEL	N	N	silent_mutation	Average:54.197; most accessible tissue: Zhenshan97 young leaf, score: 90.175	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0403254268	T	C	0.04	0.02	0.01	0.03	0.03	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403254268	3.94E-06	1.44E-16	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403254268	NA	2.57E-09	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403254268	4.05E-07	NA	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403254268	NA	5.23E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403254268	9.19E-06	NA	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403254268	NA	2.75E-10	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403254268	5.15E-08	1.94E-37	mr1757	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403254268	NA	5.69E-12	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403254268	1.30E-06	2.30E-33	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403254268	NA	1.09E-08	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403254268	NA	2.94E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403254268	2.99E-06	5.87E-28	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403254268	NA	4.90E-10	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251