Variant ID: vg0402823495 (JBrowse) | Variation Type: INDEL |
Chromosome: chr04 | Position: 2823495 |
Reference Allele: GTATA | Alternative Allele: G,CTATA |
Primary Allele: GTATA | Secondary Allele: CTATA |
Inferred Ancestral Allele: Not determined.
TTTTGTATTATATATTTTCTAGGAACTGTTTTAGCTCTTATCGGAACTTGGATATATATTATGTGTGGCAAGAATAGTTAGAAATAGGAATATATAGGGT[GTATA/G,CTATA]
TATATTGTGAAATAAGATCAGAATTCAAGATTAAATATGTTGAAGTTAAAATACCTTCAATTTCTTTATCCTTATCCCCAACTTTCATTCTAATCCTAAT
ATTAGGATTAGAATGAAAGTTGGGGATAAGGATAAAGAAATTGAAGGTATTTTAACTTCAACATATTTAATCTTGAATTCTGATCTTATTTCACAATATA[TATAC/C,TATAG]
ACCCTATATATTCCTATTTCTAACTATTCTTGCCACACATAATATATATCCAAGTTCCGATAAGAGCTAAAACAGTTCCTAGAAAATATATAATACAAAA
Populations | Population Size | Frequency of GTATA(primary allele) | Frequency of CTATA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 57.70% | 6.10% | 11.26% | 24.44% | G: 0.51% |
All Indica | 2759 | 41.20% | 4.90% | 16.75% | 36.43% | G: 0.69% |
All Japonica | 1512 | 84.00% | 9.90% | 2.31% | 3.77% | G: 0.07% |
Aus | 269 | 75.10% | 1.10% | 7.06% | 15.24% | G: 1.49% |
Indica I | 595 | 37.00% | 0.20% | 22.69% | 39.33% | G: 0.84% |
Indica II | 465 | 50.10% | 0.90% | 16.99% | 31.18% | G: 0.86% |
Indica III | 913 | 32.70% | 10.40% | 15.66% | 40.20% | G: 0.99% |
Indica Intermediate | 786 | 49.10% | 4.50% | 13.36% | 32.95% | G: 0.13% |
Temperate Japonica | 767 | 77.70% | 18.00% | 1.83% | 2.35% | G: 0.13% |
Tropical Japonica | 504 | 92.50% | 0.80% | 3.37% | 3.37% | NA |
Japonica Intermediate | 241 | 86.30% | 2.90% | 1.66% | 9.13% | NA |
VI/Aromatic | 96 | 63.50% | 1.00% | 3.12% | 32.29% | NA |
Intermediate | 90 | 61.10% | 1.10% | 14.44% | 23.33% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0402823495 | GTATA -> DEL | N | N | silent_mutation | Average:38.965; most accessible tissue: Callus, score: 67.365 | N | N | N | N |
vg0402823495 | GTATA -> G | LOC_Os04g05570.1 | upstream_gene_variant ; 1603.0bp to feature; MODIFIER | silent_mutation | Average:38.965; most accessible tissue: Callus, score: 67.365 | N | N | N | N |
vg0402823495 | GTATA -> G | LOC_Os04g05580.1 | upstream_gene_variant ; 2654.0bp to feature; MODIFIER | silent_mutation | Average:38.965; most accessible tissue: Callus, score: 67.365 | N | N | N | N |
vg0402823495 | GTATA -> G | LOC_Os04g05570-LOC_Os04g05580 | intergenic_region ; MODIFIER | silent_mutation | Average:38.965; most accessible tissue: Callus, score: 67.365 | N | N | N | N |
vg0402823495 | GTATA -> CTATA | LOC_Os04g05570.1 | upstream_gene_variant ; 1602.0bp to feature; MODIFIER | silent_mutation | Average:38.965; most accessible tissue: Callus, score: 67.365 | N | N | N | N |
vg0402823495 | GTATA -> CTATA | LOC_Os04g05580.1 | upstream_gene_variant ; 2655.0bp to feature; MODIFIER | silent_mutation | Average:38.965; most accessible tissue: Callus, score: 67.365 | N | N | N | N |
vg0402823495 | GTATA -> CTATA | LOC_Os04g05570-LOC_Os04g05580 | intergenic_region ; MODIFIER | silent_mutation | Average:38.965; most accessible tissue: Callus, score: 67.365 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0402823495 | NA | 1.21E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0402823495 | 2.13E-08 | NA | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0402823495 | 2.64E-07 | NA | Heading_date | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0402823495 | NA | 2.14E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402823495 | NA | 2.80E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0402823495 | NA | 3.09E-08 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |