\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402823495:

Variant ID: vg0402823495 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 2823495
Reference Allele: GTATAAlternative Allele: G,CTATA
Primary Allele: GTATASecondary Allele: CTATA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTGTATTATATATTTTCTAGGAACTGTTTTAGCTCTTATCGGAACTTGGATATATATTATGTGTGGCAAGAATAGTTAGAAATAGGAATATATAGGGT[GTATA/G,CTATA]
TATATTGTGAAATAAGATCAGAATTCAAGATTAAATATGTTGAAGTTAAAATACCTTCAATTTCTTTATCCTTATCCCCAACTTTCATTCTAATCCTAAT

Reverse complement sequence

ATTAGGATTAGAATGAAAGTTGGGGATAAGGATAAAGAAATTGAAGGTATTTTAACTTCAACATATTTAATCTTGAATTCTGATCTTATTTCACAATATA[TATAC/C,TATAG]
ACCCTATATATTCCTATTTCTAACTATTCTTGCCACACATAATATATATCCAAGTTCCGATAAGAGCTAAAACAGTTCCTAGAAAATATATAATACAAAA

Allele Frequencies:

Populations Population SizeFrequency of GTATA(primary allele) Frequency of CTATA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 6.10% 11.26% 24.44% G: 0.51%
All Indica  2759 41.20% 4.90% 16.75% 36.43% G: 0.69%
All Japonica  1512 84.00% 9.90% 2.31% 3.77% G: 0.07%
Aus  269 75.10% 1.10% 7.06% 15.24% G: 1.49%
Indica I  595 37.00% 0.20% 22.69% 39.33% G: 0.84%
Indica II  465 50.10% 0.90% 16.99% 31.18% G: 0.86%
Indica III  913 32.70% 10.40% 15.66% 40.20% G: 0.99%
Indica Intermediate  786 49.10% 4.50% 13.36% 32.95% G: 0.13%
Temperate Japonica  767 77.70% 18.00% 1.83% 2.35% G: 0.13%
Tropical Japonica  504 92.50% 0.80% 3.37% 3.37% NA
Japonica Intermediate  241 86.30% 2.90% 1.66% 9.13% NA
VI/Aromatic  96 63.50% 1.00% 3.12% 32.29% NA
Intermediate  90 61.10% 1.10% 14.44% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402823495 GTATA -> DEL N N silent_mutation Average:38.965; most accessible tissue: Callus, score: 67.365 N N N N
vg0402823495 GTATA -> G LOC_Os04g05570.1 upstream_gene_variant ; 1603.0bp to feature; MODIFIER silent_mutation Average:38.965; most accessible tissue: Callus, score: 67.365 N N N N
vg0402823495 GTATA -> G LOC_Os04g05580.1 upstream_gene_variant ; 2654.0bp to feature; MODIFIER silent_mutation Average:38.965; most accessible tissue: Callus, score: 67.365 N N N N
vg0402823495 GTATA -> G LOC_Os04g05570-LOC_Os04g05580 intergenic_region ; MODIFIER silent_mutation Average:38.965; most accessible tissue: Callus, score: 67.365 N N N N
vg0402823495 GTATA -> CTATA LOC_Os04g05570.1 upstream_gene_variant ; 1602.0bp to feature; MODIFIER silent_mutation Average:38.965; most accessible tissue: Callus, score: 67.365 N N N N
vg0402823495 GTATA -> CTATA LOC_Os04g05580.1 upstream_gene_variant ; 2655.0bp to feature; MODIFIER silent_mutation Average:38.965; most accessible tissue: Callus, score: 67.365 N N N N
vg0402823495 GTATA -> CTATA LOC_Os04g05570-LOC_Os04g05580 intergenic_region ; MODIFIER silent_mutation Average:38.965; most accessible tissue: Callus, score: 67.365 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402823495 NA 1.21E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0402823495 2.13E-08 NA Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0402823495 2.64E-07 NA Heading_date Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0402823495 NA 2.14E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402823495 NA 2.80E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402823495 NA 3.09E-08 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251