\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402048811:

Variant ID: vg0402048811 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2048811
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.50, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTATATTACCTGGAAATTCTGTGGTGAGGAGCCAAATGAGAAATTACTTCAGGGCTTGATTGTGGCCGAGTTTAGTTCCAAACTATTTCTTCAAACTT[T/C]
TAATTTTTTCATCACATCGAAATTTTCCTACACACGTAAACTTCCAACTTTTCCGTCACATCGTTCCAATTTTAACCAAACTTTCAATTTTATCGTGAAC

Reverse complement sequence

GTTCACGATAAAATTGAAAGTTTGGTTAAAATTGGAACGATGTGACGGAAAAGTTGGAAGTTTACGTGTGTAGGAAAATTTCGATGTGATGAAAAAATTA[A/G]
AAGTTTGAAGAAATAGTTTGGAACTAAACTCGGCCACAATCAAGCCCTGAAGTAATTTCTCATTTGGCTCCTCACCACAGAATTTCCAGGTAATATACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 37.50% 0.59% 0.40% NA
All Indica  2759 73.30% 26.50% 0.11% 0.04% NA
All Japonica  1512 38.60% 59.90% 0.33% 1.12% NA
Aus  269 86.60% 13.40% 0.00% 0.00% NA
Indica I  595 77.60% 22.40% 0.00% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 59.10% 40.60% 0.11% 0.11% NA
Indica Intermediate  786 73.70% 26.10% 0.25% 0.00% NA
Temperate Japonica  767 7.40% 92.30% 0.26% 0.00% NA
Tropical Japonica  504 72.60% 23.80% 0.20% 3.37% NA
Japonica Intermediate  241 66.80% 32.40% 0.83% 0.00% NA
VI/Aromatic  96 16.70% 63.50% 19.79% 0.00% NA
Intermediate  90 57.80% 40.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402048811 T -> C LOC_Os04g04340.1 upstream_gene_variant ; 4828.0bp to feature; MODIFIER silent_mutation Average:47.518; most accessible tissue: Callus, score: 85.415 N N N N
vg0402048811 T -> C LOC_Os04g04340-LOC_Os04g04360 intergenic_region ; MODIFIER silent_mutation Average:47.518; most accessible tissue: Callus, score: 85.415 N N N N
vg0402048811 T -> DEL N N silent_mutation Average:47.518; most accessible tissue: Callus, score: 85.415 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402048811 NA 2.98E-13 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0402048811 NA 2.68E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048811 NA 1.98E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048811 NA 7.02E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048811 NA 2.61E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048811 NA 1.25E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048811 NA 2.17E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048811 NA 1.25E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048811 NA 6.33E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048811 NA 8.33E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048811 NA 7.56E-10 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048811 3.64E-07 NA mr1798_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402048811 1.58E-08 1.01E-10 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251