\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401742334:

Variant ID: vg0401742334 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1742334
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGACGACTGATGCTGTCCAGGCGAAAGAGCAGCTGGTTGATCGTTGCCATCAGATGCTCTTTGGTCAGCTCCCAGCACTGCTTGTAAAGCCATCAGGT[C/T]
CAGCAGGGTTTACACTTTTGTTTTCCAACAAAATTACAGAATTTCGGTGGTCGGTACTTTTCATTATGAAATTATATGACAATTTTACTAAATATGAATG

Reverse complement sequence

CATTCATATTTAGTAAAATTGTCATATAATTTCATAATGAAAAGTACCGACCACCGAAATTCTGTAATTTTGTTGGAAAACAAAAGTGTAAACCCTGCTG[G/A]
ACCTGATGGCTTTACAAGCAGTGCTGGGAGCTGACCAAAGAGCATCTGATGGCAACGATCAACCAGCTGCTCTTTCGCCTGGACAGCATCAGTCGTCTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.30% 20.10% 0.89% 33.73% NA
All Indica  2759 38.60% 18.80% 1.09% 41.50% NA
All Japonica  1512 47.90% 27.20% 0.66% 24.14% NA
Aus  269 90.70% 0.40% 0.37% 8.55% NA
Indica I  595 23.20% 1.20% 1.51% 74.12% NA
Indica II  465 44.30% 35.10% 0.43% 20.22% NA
Indica III  913 45.50% 25.10% 0.55% 28.92% NA
Indica Intermediate  786 38.80% 15.40% 1.78% 44.02% NA
Temperate Japonica  767 71.30% 2.60% 0.78% 25.29% NA
Tropical Japonica  504 10.90% 65.70% 0.40% 23.02% NA
Japonica Intermediate  241 51.00% 25.30% 0.83% 22.82% NA
VI/Aromatic  96 59.40% 4.20% 0.00% 36.46% NA
Intermediate  90 56.70% 13.30% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401742334 C -> DEL N N silent_mutation Average:38.706; most accessible tissue: Minghui63 root, score: 71.259 N N N N
vg0401742334 C -> T LOC_Os04g03850.1 downstream_gene_variant ; 1336.0bp to feature; MODIFIER silent_mutation Average:38.706; most accessible tissue: Minghui63 root, score: 71.259 N N N N
vg0401742334 C -> T LOC_Os04g03850-LOC_Os04g03860 intergenic_region ; MODIFIER silent_mutation Average:38.706; most accessible tissue: Minghui63 root, score: 71.259 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401742334 NA 1.73E-13 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401742334 NA 6.06E-07 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 1.99E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 4.02E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 1.97E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 8.61E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 5.95E-18 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 6.75E-15 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 8.95E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 3.36E-07 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 4.55E-08 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 9.77E-12 mr1668 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 1.39E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 2.95E-13 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 1.52E-15 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 5.02E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 3.35E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 2.17E-22 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 1.52E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 9.68E-07 mr1363_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 1.80E-10 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 1.35E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 3.84E-15 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 3.19E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 8.15E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 1.36E-16 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334 NA 2.24E-14 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251