Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401742334:

Variant ID: vg0401742334 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1742334
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGACGACTGATGCTGTCCAGGCGAAAGAGCAGCTGGTTGATCGTTGCCATCAGATGCTCTTTGGTCAGCTCCCAGCACTGCTTGTAAAGCCATCAGGT[C/T]
CAGCAGGGTTTACACTTTTGTTTTCCAACAAAATTACAGAATTTCGGTGGTCGGTACTTTTCATTATGAAATTATATGACAATTTTACTAAATATGAATG

Reverse complement sequence

CATTCATATTTAGTAAAATTGTCATATAATTTCATAATGAAAAGTACCGACCACCGAAATTCTGTAATTTTGTTGGAAAACAAAAGTGTAAACCCTGCTG[G/A]
ACCTGATGGCTTTACAAGCAGTGCTGGGAGCTGACCAAAGAGCATCTGATGGCAACGATCAACCAGCTGCTCTTTCGCCTGGACAGCATCAGTCGTCTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.30%	20.10%	0.89%	33.73%	NA
All Indica	2759	38.60%	18.80%	1.09%	41.50%	NA
All Japonica	1512	47.90%	27.20%	0.66%	24.14%	NA
Aus	269	90.70%	0.40%	0.37%	8.55%	NA
Indica I	595	23.20%	1.20%	1.51%	74.12%	NA
Indica II	465	44.30%	35.10%	0.43%	20.22%	NA
Indica III	913	45.50%	25.10%	0.55%	28.92%	NA
Indica Intermediate	786	38.80%	15.40%	1.78%	44.02%	NA
Temperate Japonica	767	71.30%	2.60%	0.78%	25.29%	NA
Tropical Japonica	504	10.90%	65.70%	0.40%	23.02%	NA
Japonica Intermediate	241	51.00%	25.30%	0.83%	22.82%	NA
VI/Aromatic	96	59.40%	4.20%	0.00%	36.46%	NA
Intermediate	90	56.70%	13.30%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401742334	C -> DEL	N	N	silent_mutation	Average:38.706; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg0401742334	C -> T	LOC_Os04g03850.1	downstream_gene_variant ; 1336.0bp to feature; MODIFIER	silent_mutation	Average:38.706; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg0401742334	C -> T	LOC_Os04g03850-LOC_Os04g03860	intergenic_region ; MODIFIER	silent_mutation	Average:38.706; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401742334	NA	1.73E-13	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401742334	NA	6.06E-07	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	1.99E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	4.02E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	1.97E-10	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	8.61E-10	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	5.95E-18	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	6.75E-15	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	8.95E-11	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	3.36E-07	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	4.55E-08	mr1525	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	9.77E-12	mr1668	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	1.39E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	2.95E-13	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	1.52E-15	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	5.02E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	3.35E-06	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	2.17E-22	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	1.52E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	9.68E-07	mr1363_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	1.80E-10	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	1.35E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	3.84E-15	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	3.19E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	8.15E-11	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	1.36E-16	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401742334	NA	2.24E-14	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251