Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0334653299:

Variant ID: vg0334653299 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34653299
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAGAACACGCTTCGACTACTTCATAGACCGTCTTTGTGCAGGCGAAAACCTGTAAAGAAGGAGGAGGGGAAAGGAGGAGATCCATACATGCACGTACGT[C/T]
GTCGTCGTCGTCGTCGGAAGGCTTGCCAAGGACCGGACCCGTCTTGCCGCCACCGCGGCCGACGCAGCGGACCGCCATCGACGTCGTCGCCGGACGCCTC

Reverse complement sequence

GAGGCGTCCGGCGACGACGTCGATGGCGGTCCGCTGCGTCGGCCGCGGTGGCGGCAAGACGGGTCCGGTCCTTGGCAAGCCTTCCGACGACGACGACGAC[G/A]
ACGTACGTGCATGTATGGATCTCCTCCTTTCCCCTCCTCCTTCTTTACAGGTTTTCGCCTGCACAAAGACGGTCTATGAAGTAGTCGAAGCGTGTTCTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.00%	41.20%	0.06%	1.82%	NA
All Indica	2759	93.10%	3.70%	0.07%	3.12%	NA
All Japonica	1512	0.90%	99.10%	0.00%	0.00%	NA
Aus	269	22.30%	77.30%	0.37%	0.00%	NA
Indica I	595	95.10%	0.20%	0.00%	4.71%	NA
Indica II	465	92.90%	4.10%	0.22%	2.80%	NA
Indica III	913	96.20%	3.70%	0.00%	0.11%	NA
Indica Intermediate	786	88.20%	6.10%	0.13%	5.60%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334653299	C -> T	LOC_Os03g60992.1	missense_variant&splice_region_variant ; p.Asp68Asn; MODERATE	nonsynonymous_codon ; D68N	Average:79.272; most accessible tissue: Zhenshan97 panicle, score: 89.143	unknown	unknown	TOLERATED	0.17
vg0334653299	C -> DEL	LOC_Os03g60992.1	N	frameshift_variant	Average:79.272; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0334653299	C	T	-0.03	-0.04	-0.04	0.0	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334653299	NA	4.30E-20	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0334653299	NA	1.16E-17	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	2.93E-67	mr1671	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	1.86E-39	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	2.23E-25	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	2.82E-74	mr1088_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	8.64E-66	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	1.06E-34	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	1.82E-20	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	1.49E-46	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	2.27E-21	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	1.16E-23	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	5.53E-90	mr1671_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	1.70E-47	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	5.29E-68	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	8.32E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	3.25E-32	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299	NA	3.46E-31	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251