\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334653299:

Variant ID: vg0334653299 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34653299
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGAACACGCTTCGACTACTTCATAGACCGTCTTTGTGCAGGCGAAAACCTGTAAAGAAGGAGGAGGGGAAAGGAGGAGATCCATACATGCACGTACGT[C/T]
GTCGTCGTCGTCGTCGGAAGGCTTGCCAAGGACCGGACCCGTCTTGCCGCCACCGCGGCCGACGCAGCGGACCGCCATCGACGTCGTCGCCGGACGCCTC

Reverse complement sequence

GAGGCGTCCGGCGACGACGTCGATGGCGGTCCGCTGCGTCGGCCGCGGTGGCGGCAAGACGGGTCCGGTCCTTGGCAAGCCTTCCGACGACGACGACGAC[G/A]
ACGTACGTGCATGTATGGATCTCCTCCTTTCCCCTCCTCCTTCTTTACAGGTTTTCGCCTGCACAAAGACGGTCTATGAAGTAGTCGAAGCGTGTTCTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 41.20% 0.06% 1.82% NA
All Indica  2759 93.10% 3.70% 0.07% 3.12% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 22.30% 77.30% 0.37% 0.00% NA
Indica I  595 95.10% 0.20% 0.00% 4.71% NA
Indica II  465 92.90% 4.10% 0.22% 2.80% NA
Indica III  913 96.20% 3.70% 0.00% 0.11% NA
Indica Intermediate  786 88.20% 6.10% 0.13% 5.60% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334653299 C -> T LOC_Os03g60992.1 missense_variant&splice_region_variant ; p.Asp68Asn; MODERATE nonsynonymous_codon ; D68N Average:79.272; most accessible tissue: Zhenshan97 panicle, score: 89.143 unknown unknown TOLERATED 0.17
vg0334653299 C -> DEL LOC_Os03g60992.1 N frameshift_variant Average:79.272; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0334653299 C T -0.03 -0.04 -0.04 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334653299 NA 4.30E-20 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0334653299 NA 1.16E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 2.93E-67 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 1.86E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 2.23E-25 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 2.82E-74 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 8.64E-66 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 1.06E-34 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 1.82E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 1.49E-46 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 2.27E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 1.16E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 5.53E-90 mr1671_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 1.70E-47 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 5.29E-68 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 8.32E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 3.25E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334653299 NA 3.46E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251