\
| Variant ID: vg0331907206 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 31907206 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAATAACTTATAATCTAAAACAGATTGAGTAATATTCAGAGGTGAATGCTACTCCTGACATAATAGGAGTACTTACTCCGTCTCAAAATGTAGCTATGTT[A/G]
TATAGGATGTGTTATTACCTAGTACTACAAATCTGGATAAGAGGTAGTATATATCTCTCCTGACATAATAGGAGTACTCCATTCATCCCAAAAAAACTCA
TGAGTTTTTTTGGGATGAATGGAGTACTCCTATTATGTCAGGAGAGATATATACTACCTCTTATCCAGATTTGTAGTACTAGGTAATAACACATCCTATA[T/C]
AACATAGCTACATTTTGAGACGGAGTAAGTACTCCTATTATGTCAGGAGTAGCATTCACCTCTGAATATTACTCAATCTGTTTTAGATTATAAGTTATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 7.60% | 1.93% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 71.30% | 22.80% | 5.95% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 52.90% | 37.20% | 9.91% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 3.60% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.80% | 17.00% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0331907206 | A -> G | LOC_Os03g56040.1 | upstream_gene_variant ; 3524.0bp to feature; MODIFIER | silent_mutation | Average:46.152; most accessible tissue: Callus, score: 92.342 | N | N | N | N |
| vg0331907206 | A -> G | LOC_Os03g56030-LOC_Os03g56040 | intergenic_region ; MODIFIER | silent_mutation | Average:46.152; most accessible tissue: Callus, score: 92.342 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0331907206 | NA | 2.47E-16 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0331907206 | NA | 1.61E-14 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0331907206 | 1.68E-07 | NA | mr1354 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | NA | 1.25E-10 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | 4.54E-06 | 2.05E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | NA | 9.82E-07 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | NA | 5.01E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | NA | 4.79E-06 | mr1138_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | 2.50E-08 | NA | mr1354_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | NA | 1.17E-11 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | NA | 9.71E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | 3.23E-06 | 4.95E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | NA | 3.28E-07 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | 1.23E-06 | 5.05E-15 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0331907206 | NA | 1.26E-08 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |