\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0329205463:

Variant ID: vg0329205463 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 29205463
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCTCGTATTGGGTTCTTATATGAAAACTTATTTCTATATTGCTTATTTTTAATTCCGAATTTCAGCTATTTTTAAATCGTATTTCTACTTGGGCTCTCC[A/T]
TTCCTTTTCTAATTTTGGGTTTTATTTTATTTTTATTTCAAATTTTAATTAATCTCGTATTGGGTTCTTATACGGAAACTTCTTTCAATATTGCTTATTT

Reverse complement sequence

AAATAAGCAATATTGAAAGAAGTTTCCGTATAAGAACCCAATACGAGATTAATTAAAATTTGAAATAAAAATAAAATAAAACCCAAAATTAGAAAAGGAA[T/A]
GGAGAGCCCAAGTAGAAATACGATTTAAAAATAGCTGAAATTCGGAATTAAAAATAAGCAATATAGAAATAAGTTTTCATATAAGAACCCAATACGAGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.80% 12.10% 3.26% 7.83% NA
All Indica  2759 92.60% 0.40% 1.05% 6.02% NA
All Japonica  1512 55.60% 36.40% 7.87% 0.07% NA
Aus  269 36.40% 0.00% 0.00% 63.57% NA
Indica I  595 97.60% 0.50% 1.85% 0.00% NA
Indica II  465 88.80% 0.90% 1.72% 8.60% NA
Indica III  913 91.60% 0.00% 0.11% 8.32% NA
Indica Intermediate  786 92.10% 0.40% 1.15% 6.36% NA
Temperate Japonica  767 23.30% 65.20% 11.34% 0.13% NA
Tropical Japonica  504 95.80% 1.80% 2.38% 0.00% NA
Japonica Intermediate  241 74.30% 17.40% 8.30% 0.00% NA
VI/Aromatic  96 72.90% 0.00% 2.08% 25.00% NA
Intermediate  90 74.40% 12.20% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0329205463 A -> T LOC_Os03g51090.1 upstream_gene_variant ; 4480.0bp to feature; MODIFIER silent_mutation Average:28.285; most accessible tissue: Zhenshan97 flower, score: 82.601 N N N N
vg0329205463 A -> T LOC_Os03g51080.1 intron_variant ; MODIFIER silent_mutation Average:28.285; most accessible tissue: Zhenshan97 flower, score: 82.601 N N N N
vg0329205463 A -> DEL N N silent_mutation Average:28.285; most accessible tissue: Zhenshan97 flower, score: 82.601 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0329205463 NA 2.19E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0329205463 NA 1.09E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0329205463 NA 8.57E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0329205463 NA 1.04E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0329205463 NA 9.44E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0329205463 NA 2.36E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 9.49E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 1.57E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 7.88E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 3.82E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 3.62E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 2.42E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 2.27E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 1.96E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 1.56E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 6.10E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 3.56E-06 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 4.41E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 1.02E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 4.13E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 1.01E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 1.70E-11 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 1.85E-07 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 4.99E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 1.01E-08 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 7.88E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 2.95E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 1.58E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 4.77E-07 4.76E-07 mr1919_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329205463 NA 3.60E-07 mr1919_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251