Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0329083556:

Variant ID: vg0329083556 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 29083556
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCAATTATAAATTAACTTCATTTAGCCACACACTCAAGTTAGGGATTTGATTGAAGAGTTAATCAGTCCCTAAACTGTGGGTCAAAGTAGAGACATACC[T/C]
AATAAATATCAACATATTTAGAATTACGATAATTATTATATTATAAATAAACAGTAATTTTCACAAGAATACTGAAACAATCGTTATAATAGCAAAATGA

Reverse complement sequence

TCATTTTGCTATTATAACGATTGTTTCAGTATTCTTGTGAAAATTACTGTTTATTTATAATATAATAATTATCGTAATTCTAAATATGTTGATATTTATT[A/G]
GGTATGTCTCTACTTTGACCCACAGTTTAGGGACTGATTAACTCTTCAATCAAATCCCTAACTTGAGTGTGTGGCTAAATGAAGTTAATTTATAATTGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 11.90% 3.03% 0.00% NA
All Indica  2759 97.30% 0.90% 1.78% 0.00% NA
All Japonica  1512 59.30% 34.70% 6.08% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 90.90% 2.70% 6.39% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 98.30% 0.50% 1.15% 0.00% NA
Temperate Japonica  767 30.50% 60.90% 8.60% 0.00% NA
Tropical Japonica  504 95.00% 2.40% 2.58% 0.00% NA
Japonica Intermediate  241 75.90% 18.70% 5.39% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0329083556 T -> C LOC_Os03g50900.1 upstream_gene_variant ; 4251.0bp to feature; MODIFIER silent_mutation Average:35.717; most accessible tissue: Callus, score: 75.07 N N N N
vg0329083556 T -> C LOC_Os03g50900-LOC_Os03g50920 intergenic_region ; MODIFIER silent_mutation Average:35.717; most accessible tissue: Callus, score: 75.07 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0329083556 NA 4.40E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0329083556 NA 6.86E-15 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0329083556 NA 9.27E-18 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0329083556 NA 8.24E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0329083556 NA 4.74E-23 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 1.21E-08 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 5.52E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 3.09E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 4.53E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 2.56E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 9.38E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 1.41E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 1.79E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 3.11E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 4.17E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 1.89E-07 9.80E-25 mr1611 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 3.63E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 1.42E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 4.19E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 1.87E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 1.75E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 3.11E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 1.43E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 6.52E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 2.50E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 3.28E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 6.76E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 2.02E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 2.02E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 NA 2.45E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329083556 6.13E-06 6.10E-06 mr1919_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251