\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328780990:

Variant ID: vg0328780990 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28780990
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTTATATGTCACATACCAAAATATGCAATTTTGTACAACTTGGATCATAATAATATGGGGTTTTACGAAATGTACTCTTAAATTTACGCTGTGGCTG[A/G]
TACTCCCTCTGTCCCGAAATATAAGGGATTTTGGTTGGATGTGACACATTCTAGTACTATGAATTTGGACAAAGAGTATGTCCAAATTCACAGTCGCAGG

Reverse complement sequence

CCTGCGACTGTGAATTTGGACATACTCTTTGTCCAAATTCATAGTACTAGAATGTGTCACATCCAACCAAAATCCCTTATATTTCGGGACAGAGGGAGTA[T/C]
CAGCCACAGCGTAAATTTAAGAGTACATTTCGTAAAACCCCATATTATTATGATCCAAGTTGTACAAAATTGCATATTTTGGTATGTGACATATAACTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 4.30% 1.65% 0.00% NA
All Indica  2759 98.30% 0.20% 1.49% 0.00% NA
All Japonica  1512 84.50% 13.20% 2.38% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.10% 0.30% 4.54% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 0.40% 1.65% 0.00% NA
Temperate Japonica  767 74.70% 21.10% 4.17% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 12.40% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328780990 A -> G LOC_Os03g50440.1 upstream_gene_variant ; 470.0bp to feature; MODIFIER silent_mutation Average:60.911; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0328780990 A -> G LOC_Os03g50430.1 downstream_gene_variant ; 3742.0bp to feature; MODIFIER silent_mutation Average:60.911; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0328780990 A -> G LOC_Os03g50430-LOC_Os03g50440 intergenic_region ; MODIFIER silent_mutation Average:60.911; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328780990 NA 1.67E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0328780990 1.70E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 3.39E-06 4.30E-07 mr1060_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 2.03E-06 3.67E-08 mr1060_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 NA 6.96E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 8.83E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 NA 1.07E-06 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 NA 1.21E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 NA 5.89E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 NA 1.23E-06 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 NA 9.98E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 NA 8.00E-08 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 5.50E-06 5.50E-06 mr1568_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 NA 6.37E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 NA 5.29E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 8.51E-07 3.41E-10 mr1821_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328780990 9.04E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251