\
| Variant ID: vg0328780990 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 28780990 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 268. )
TAAGTTATATGTCACATACCAAAATATGCAATTTTGTACAACTTGGATCATAATAATATGGGGTTTTACGAAATGTACTCTTAAATTTACGCTGTGGCTG[A/G]
TACTCCCTCTGTCCCGAAATATAAGGGATTTTGGTTGGATGTGACACATTCTAGTACTATGAATTTGGACAAAGAGTATGTCCAAATTCACAGTCGCAGG
CCTGCGACTGTGAATTTGGACATACTCTTTGTCCAAATTCATAGTACTAGAATGTGTCACATCCAACCAAAATCCCTTATATTTCGGGACAGAGGGAGTA[T/C]
CAGCCACAGCGTAAATTTAAGAGTACATTTCGTAAAACCCCATATTATTATGATCCAAGTTGTACAAAATTGCATATTTTGGTATGTGACATATAACTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 4.30% | 1.65% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 0.20% | 1.49% | 0.00% | NA |
| All Japonica | 1512 | 84.50% | 13.20% | 2.38% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.10% | 0.30% | 4.54% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 0.40% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 74.70% | 21.10% | 4.17% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 12.40% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0328780990 | A -> G | LOC_Os03g50440.1 | upstream_gene_variant ; 470.0bp to feature; MODIFIER | silent_mutation | Average:60.911; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0328780990 | A -> G | LOC_Os03g50430.1 | downstream_gene_variant ; 3742.0bp to feature; MODIFIER | silent_mutation | Average:60.911; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0328780990 | A -> G | LOC_Os03g50430-LOC_Os03g50440 | intergenic_region ; MODIFIER | silent_mutation | Average:60.911; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0328780990 | NA | 1.67E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0328780990 | 1.70E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | 3.39E-06 | 4.30E-07 | mr1060_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | 2.03E-06 | 3.67E-08 | mr1060_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | NA | 6.96E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | 8.83E-06 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | NA | 1.07E-06 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | NA | 1.21E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | NA | 5.89E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | NA | 1.23E-06 | mr1358_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | NA | 9.98E-06 | mr1452_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | NA | 8.00E-08 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | 5.50E-06 | 5.50E-06 | mr1568_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | NA | 6.37E-06 | mr1686_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | NA | 5.29E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | 8.51E-07 | 3.41E-10 | mr1821_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328780990 | 9.04E-06 | NA | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |