\
| Variant ID: vg0328227704 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 28227704 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTAGTTAATATAATAAAAATTGTATAGTTGACCACTATTTTAATTAACATATTACATATAAATGGACCACATTTACTTTAAATTCTAGCTACGCTACTGG[T/G]
TTTACATGCACGTTGAGAGGTTCCCAACCTCTCACCCCGAAACAGAGAGTATCTAGTCCAGTCAGTGTGACACATACTCTATTGTTGACGGACAGTGGAA
TTCCACTGTCCGTCAACAATAGAGTATGTGTCACACTGACTGGACTAGATACTCTCTGTTTCGGGGTGAGAGGTTGGGAACCTCTCAACGTGCATGTAAA[A/C]
CCAGTAGCGTAGCTAGAATTTAAAGTAAATGTGGTCCATTTATATGTAATATGTTAATTAAAATAGTGGTCAACTATACAATTTTTATTATATTAACTAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 3.90% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 86.80% | 12.00% | 1.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 79.10% | 18.80% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 12.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0328227704 | T -> G | LOC_Os03g49560.1 | upstream_gene_variant ; 2346.0bp to feature; MODIFIER | silent_mutation | Average:63.362; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0328227704 | T -> G | LOC_Os03g49570.1 | upstream_gene_variant ; 1584.0bp to feature; MODIFIER | silent_mutation | Average:63.362; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0328227704 | T -> G | LOC_Os03g49560-LOC_Os03g49570 | intergenic_region ; MODIFIER | silent_mutation | Average:63.362; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0328227704 | NA | 1.04E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0328227704 | 1.25E-06 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328227704 | 9.17E-10 | NA | mr1310 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328227704 | 8.80E-06 | NA | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328227704 | 8.79E-11 | NA | mr1926 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328227704 | 1.26E-11 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328227704 | 6.91E-06 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328227704 | 1.86E-07 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328227704 | 8.47E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328227704 | 8.28E-08 | NA | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |