\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326027307:

Variant ID: vg0326027307 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26027307
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGATTTTATTCAAGCTCGGTGATAAATTGAGGAACATCATGTGAACTTATTCCTACTTAAAAAAAGGAAAGCCGGGCTAAAAAGCTAGGGCCGAAAAT[G/T]
GAAGCTAGGCTTGATCGCTCGCACACCCTCACGCGTGACTATTCACTGATTAGTGATTTCGGAGTCTTCTGAGTGGAGAAGTGCTTCGTAAACGCCCAAC

Reverse complement sequence

GTTGGGCGTTTACGAAGCACTTCTCCACTCAGAAGACTCCGAAATCACTAATCAGTGAATAGTCACGCGTGAGGGTGTGCGAGCGATCAAGCCTAGCTTC[C/A]
ATTTTCGGCCCTAGCTTTTTAGCCCGGCTTTCCTTTTTTTAAGTAGGAATAAGTTCACATGATGTTCCTCAATTTATCACCGAGCTTGAATAAAATCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 9.70% 0.04% 0.40% NA
All Indica  2759 83.20% 16.20% 0.07% 0.54% NA
All Japonica  1512 99.70% 0.20% 0.00% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 47.50% 50.50% 0.22% 1.72% NA
Indica III  913 92.00% 7.70% 0.00% 0.33% NA
Indica Intermediate  786 81.60% 17.80% 0.13% 0.51% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326027307 G -> T LOC_Os03g46052.1 upstream_gene_variant ; 1932.0bp to feature; MODIFIER silent_mutation Average:38.46; most accessible tissue: Callus, score: 74.066 N N N N
vg0326027307 G -> T LOC_Os03g46040.1 downstream_gene_variant ; 4398.0bp to feature; MODIFIER silent_mutation Average:38.46; most accessible tissue: Callus, score: 74.066 N N N N
vg0326027307 G -> T LOC_Os03g46040-LOC_Os03g46052 intergenic_region ; MODIFIER silent_mutation Average:38.46; most accessible tissue: Callus, score: 74.066 N N N N
vg0326027307 G -> DEL N N silent_mutation Average:38.46; most accessible tissue: Callus, score: 74.066 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326027307 NA 2.90E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326027307 NA 2.13E-12 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326027307 NA 8.94E-10 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 8.74E-09 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 1.93E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 8.27E-07 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 8.41E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 1.50E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 6.37E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 6.17E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 1.33E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 1.58E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 7.70E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 5.94E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 3.60E-07 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 9.79E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 1.85E-07 3.46E-08 mr1984 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 4.33E-07 2.58E-09 mr1984 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 2.26E-06 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 3.26E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326027307 NA 2.55E-07 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251