\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0325099885:

Variant ID: vg0325099885 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 25099885
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTGTACCCATTAAATTAACAATTTAAAAAGTACACGATGTAATCATCGGATCTATTATTTGCTAATAAATAAAGCGTCAAAAATTCTCTTTTTGCCCG[T/C]
TGCATAATGCACGTCTGCACTTTTACCTTTCGCACGTGTGACAAAGCATAGTGTCTGAGACATTTAAGGTGATCACAACCGCTATAGCACTACCGCTTTG

Reverse complement sequence

CAAAGCGGTAGTGCTATAGCGGTTGTGATCACCTTAAATGTCTCAGACACTATGCTTTGTCACACGTGCGAAAGGTAAAAGTGCAGACGTGCATTATGCA[A/G]
CGGGCAAAAAGAGAATTTTTGACGCTTTATTTATTAGCAAATAATAGATCCGATGATTACATCGTGTACTTTTTAAATTGTTAATTTAATGGGTACACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 7.80% 3.36% 0.00% NA
All Indica  2759 98.00% 1.10% 0.94% 0.00% NA
All Japonica  1512 69.70% 21.90% 8.40% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.30% 3.20% 2.52% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 1.40% 1.40% 0.00% NA
Temperate Japonica  767 49.00% 38.10% 12.91% 0.00% NA
Tropical Japonica  504 95.80% 2.60% 1.59% 0.00% NA
Japonica Intermediate  241 80.90% 10.80% 8.30% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 2.08% 0.00% NA
Intermediate  90 86.70% 8.90% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0325099885 T -> C LOC_Os03g44560.1 upstream_gene_variant ; 2995.0bp to feature; MODIFIER silent_mutation Average:48.065; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0325099885 T -> C LOC_Os03g44580.1 downstream_gene_variant ; 2609.0bp to feature; MODIFIER silent_mutation Average:48.065; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0325099885 T -> C LOC_Os03g44580.3 downstream_gene_variant ; 1895.0bp to feature; MODIFIER silent_mutation Average:48.065; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0325099885 T -> C LOC_Os03g44580.2 downstream_gene_variant ; 2612.0bp to feature; MODIFIER silent_mutation Average:48.065; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0325099885 T -> C LOC_Os03g44560-LOC_Os03g44580 intergenic_region ; MODIFIER silent_mutation Average:48.065; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0325099885 NA 1.20E-09 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0325099885 NA 5.59E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 NA 4.62E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 NA 5.32E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 NA 6.99E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 2.53E-06 2.44E-12 mr1902 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 NA 7.37E-08 mr1902 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 NA 5.61E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 NA 2.22E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 NA 4.57E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 NA 3.29E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 NA 7.09E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 NA 3.62E-07 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325099885 NA 1.15E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251