\
| Variant ID: vg0325099885 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 25099885 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )
TTGTGTACCCATTAAATTAACAATTTAAAAAGTACACGATGTAATCATCGGATCTATTATTTGCTAATAAATAAAGCGTCAAAAATTCTCTTTTTGCCCG[T/C]
TGCATAATGCACGTCTGCACTTTTACCTTTCGCACGTGTGACAAAGCATAGTGTCTGAGACATTTAAGGTGATCACAACCGCTATAGCACTACCGCTTTG
CAAAGCGGTAGTGCTATAGCGGTTGTGATCACCTTAAATGTCTCAGACACTATGCTTTGTCACACGTGCGAAAGGTAAAAGTGCAGACGTGCATTATGCA[A/G]
CGGGCAAAAAGAGAATTTTTGACGCTTTATTTATTAGCAAATAATAGATCCGATGATTACATCGTGTACTTTTTAAATTGTTAATTTAATGGGTACACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.80% | 7.80% | 3.36% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 1.10% | 0.94% | 0.00% | NA |
| All Japonica | 1512 | 69.70% | 21.90% | 8.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 3.20% | 2.52% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 1.40% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 49.00% | 38.10% | 12.91% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 2.60% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 10.80% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 8.90% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0325099885 | T -> C | LOC_Os03g44560.1 | upstream_gene_variant ; 2995.0bp to feature; MODIFIER | silent_mutation | Average:48.065; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0325099885 | T -> C | LOC_Os03g44580.1 | downstream_gene_variant ; 2609.0bp to feature; MODIFIER | silent_mutation | Average:48.065; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0325099885 | T -> C | LOC_Os03g44580.3 | downstream_gene_variant ; 1895.0bp to feature; MODIFIER | silent_mutation | Average:48.065; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0325099885 | T -> C | LOC_Os03g44580.2 | downstream_gene_variant ; 2612.0bp to feature; MODIFIER | silent_mutation | Average:48.065; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0325099885 | T -> C | LOC_Os03g44560-LOC_Os03g44580 | intergenic_region ; MODIFIER | silent_mutation | Average:48.065; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0325099885 | NA | 1.20E-09 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0325099885 | NA | 5.59E-07 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | NA | 4.62E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | NA | 5.32E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | NA | 6.99E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | 2.53E-06 | 2.44E-12 | mr1902 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | NA | 7.37E-08 | mr1902 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | NA | 5.61E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | NA | 2.22E-10 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | NA | 4.57E-06 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | NA | 3.29E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | NA | 7.09E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | NA | 3.62E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325099885 | NA | 1.15E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |