RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0324205406:

Variant ID: vg0324205406 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24205406
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATTAGAGTTCACATGAAAAAGTTATGAATTATTTTTAAATATAAAGTCTTTAGACCGTCCTATTTGACCCAGATGATATTCAAATCCAAATTTAGGGAC[T/C]
GAGGTGGCACAACTGAACAAGTTGGAGGACCTAAACGAGTGATCTATAAGTTTAGGGATCGGAATGACACAGTCGAACAAGTTTAAGGATATGAACGGTC

Reverse complement sequence

GACCGTTCATATCCTTAAACTTGTTCGACTGTGTCATTCCGATCCCTAAACTTATAGATCACTCGTTTAGGTCCTCCAACTTGTTCAGTTGTGCCACCTC[A/G]
GTCCCTAAATTTGGATTTGAATATCATCTGGGTCAAATAGGACGGTCTAAAGACTTTATATTTAAAAATAATTCATAACTTTTTCATGTGAACTCTAATG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.60%	8.80%	1.59%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.04%	0.00%	NA
All Japonica	1512	68.40%	26.90%	4.70%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	44.70%	48.20%	7.04%	0.00%	NA
Tropical Japonica	504	95.00%	3.60%	1.39%	0.00%	NA
Japonica Intermediate	241	88.00%	7.90%	4.15%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	7.80%	3.33%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324205406	T -> C	LOC_Os03g43400.1	upstream_gene_variant ; 3385.0bp to feature; MODIFIER	silent_mutation	Average:22.578; most accessible tissue: Zhenshan97 flower, score: 37.704	N	N	N	N
vg0324205406	T -> C	LOC_Os03g43400-LOC_Os03g43410	intergenic_region ; MODIFIER	silent_mutation	Average:22.578; most accessible tissue: Zhenshan97 flower, score: 37.704	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324205406	NA	9.63E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0324205406	2.48E-06	NA	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205406	NA	5.12E-08	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205406	NA	1.73E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205406	NA	5.31E-06	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205406	NA	8.69E-07	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205406	8.44E-07	NA	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205406	NA	4.39E-08	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205406	7.71E-07	NA	mr1486_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324205406	NA	1.29E-11	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 14 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0324205406:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact