\
| Variant ID: vg0324205406 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24205406 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATTAGAGTTCACATGAAAAAGTTATGAATTATTTTTAAATATAAAGTCTTTAGACCGTCCTATTTGACCCAGATGATATTCAAATCCAAATTTAGGGAC[T/C]
GAGGTGGCACAACTGAACAAGTTGGAGGACCTAAACGAGTGATCTATAAGTTTAGGGATCGGAATGACACAGTCGAACAAGTTTAAGGATATGAACGGTC
GACCGTTCATATCCTTAAACTTGTTCGACTGTGTCATTCCGATCCCTAAACTTATAGATCACTCGTTTAGGTCCTCCAACTTGTTCAGTTGTGCCACCTC[A/G]
GTCCCTAAATTTGGATTTGAATATCATCTGGGTCAAATAGGACGGTCTAAAGACTTTATATTTAAAAATAATTCATAACTTTTTCATGTGAACTCTAATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.60% | 8.80% | 1.59% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 68.40% | 26.90% | 4.70% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 44.70% | 48.20% | 7.04% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 3.60% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 7.90% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 7.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324205406 | T -> C | LOC_Os03g43400.1 | upstream_gene_variant ; 3385.0bp to feature; MODIFIER | silent_mutation | Average:22.578; most accessible tissue: Zhenshan97 flower, score: 37.704 | N | N | N | N |
| vg0324205406 | T -> C | LOC_Os03g43400-LOC_Os03g43410 | intergenic_region ; MODIFIER | silent_mutation | Average:22.578; most accessible tissue: Zhenshan97 flower, score: 37.704 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324205406 | NA | 9.63E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0324205406 | 2.48E-06 | NA | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | NA | 5.12E-08 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | NA | 1.73E-07 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | NA | 5.31E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | NA | 8.69E-07 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | 8.44E-07 | NA | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | NA | 4.39E-08 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | 7.71E-07 | NA | mr1486_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | NA | 1.29E-11 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | 2.17E-07 | NA | mr1588_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | NA | 7.46E-09 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | NA | 7.29E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324205406 | NA | 1.60E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |