\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323665466:

Variant ID: vg0323665466 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23665466
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGAGGAAGTGATGGCCATTTCTCCACTCGAGCCCCCAGAGTCTATTTTTGATGAATCCATCGAAGAATTTAATGAAGGGGAGGATGAAACTGGAGAA[C/A]
CGATGGATCAGCCAAAAACGGATCTGTCGTCACGAGCCCCAATTGAGCTAAAGCCCTTACCTTCAGGCCTACGTTATGCATTTCTGAACGGCGATGCGGA

Reverse complement sequence

TCCGCATCGCCGTTCAGAAATGCATAACGTAGGCCTGAAGGTAAGGGCTTTAGCTCAATTGGGGCTCGTGACGACAGATCCGTTTTTGGCTGATCCATCG[G/T]
TTCTCCAGTTTCATCCTCCCCTTCATTAAATTCTTCGATGGATTCATCAAAAATAGACTCTGGGGGCTCGAGTGGAGAAATGGCCATCACTTCCTCAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 10.60% 1.23% 0.00% NA
All Indica  2759 99.80% 0.10% 0.07% 0.00% NA
All Japonica  1512 66.50% 30.20% 3.31% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 43.50% 52.20% 4.30% 0.00% NA
Tropical Japonica  504 92.30% 5.80% 1.98% 0.00% NA
Japonica Intermediate  241 85.50% 11.60% 2.90% 0.00% NA
VI/Aromatic  96 64.60% 33.30% 2.08% 0.00% NA
Intermediate  90 87.80% 8.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323665466 C -> A LOC_Os03g42530.1 missense_variant ; p.Pro433Thr; MODERATE nonsynonymous_codon ; P433T Average:42.731; most accessible tissue: Minghui63 young leaf, score: 62.741 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323665466 NA 5.54E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323665466 NA 2.17E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323665466 6.40E-08 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 2.98E-07 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 8.11E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 8.18E-08 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 3.25E-08 NA mr1765 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 8.42E-07 7.70E-06 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 2.74E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 8.30E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 4.69E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 1.03E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 1.35E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 5.73E-07 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 1.59E-07 NA mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 4.52E-06 NA mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 3.06E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 7.99E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 1.60E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 8.77E-07 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 5.22E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 6.17E-07 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 1.95E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323665466 NA 4.47E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251