\
| Variant ID: vg0322577580 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22577580 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 241. )
TCATATCCGTGGGACATGCCATATCAGCGCCACATAGGATCCTGAAGGGGCTGTGGTGATTTCGGACCTAGATGACACACTATGACAAGTTCTGGGACTT[G/A]
GATATGCATTTTGAGAGTTTAAGGATCTAGATGATACACCGCTATAAGTTTAAGGACCGCCCGTGCACCTTAATCATTACTAAAAGTGCGTAGCTAGGGT
ACCCTAGCTACGCACTTTTAGTAATGATTAAGGTGCACGGGCGGTCCTTAAACTTATAGCGGTGTATCATCTAGATCCTTAAACTCTCAAAATGCATATC[C/T]
AAGTCCCAGAACTTGTCATAGTGTGTCATCTAGGTCCGAAATCACCACAGCCCCTTCAGGATCCTATGTGGCGCTGATATGGCATGTCCCACGGATATGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.10% | 29.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 57.40% | 42.50% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 23.40% | 76.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 50.50% | 49.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 54.60% | 45.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322577580 | G -> A | LOC_Os03g40610.1 | upstream_gene_variant ; 3572.0bp to feature; MODIFIER | silent_mutation | Average:36.679; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| vg0322577580 | G -> A | LOC_Os03g40610-LOC_Os03g40630 | intergenic_region ; MODIFIER | silent_mutation | Average:36.679; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322577580 | NA | 2.85E-13 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0322577580 | NA | 4.48E-23 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0322577580 | NA | 4.61E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322577580 | NA | 3.31E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322577580 | NA | 2.94E-10 | mr1291 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322577580 | NA | 1.40E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322577580 | NA | 2.88E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322577580 | NA | 3.94E-07 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322577580 | NA | 9.12E-07 | mr1024_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322577580 | NA | 1.40E-07 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322577580 | NA | 5.01E-07 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322577580 | NA | 1.74E-06 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |