Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0322395432:

Variant ID: vg0322395432 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22395432
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGATCTCGATCCCTCTCGTGACGGTCGACAAATCTAGACCCGCAAAGATAAACACACTGTTGAGTTTACTAGTCCACCGTGCTAGCTAGCTAGGTGTCGC[G/A]
TTCAACTACTTGTGATGTCTCTGGAGATCATATCGCTAACTGATCAGTACTAACTACAGTATTAACCAATAGCTGCTACTCTGTCCTTTTCATACTTTTC

Reverse complement sequence

GAAAAGTATGAAAAGGACAGAGTAGCAGCTATTGGTTAATACTGTAGTTAGTACTGATCAGTTAGCGATATGATCTCCAGAGACATCACAAGTAGTTGAA[C/T]
GCGACACCTAGCTAGCTAGCACGGTGGACTAGTAAACTCAACAGTGTGTTTATCTTTGCGGGTCTAGATTTGTCGACCGTCACGAGAGGGATCGAGATCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.40%	8.30%	1.33%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	72.20%	23.60%	4.17%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	81.60%	12.60%	5.74%	0.00%	NA
Tropical Japonica	504	51.00%	47.00%	1.98%	0.00%	NA
Japonica Intermediate	241	86.70%	9.50%	3.73%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322395432	G -> A	LOC_Os03g40290.1	downstream_gene_variant ; 4440.0bp to feature; MODIFIER	silent_mutation	Average:73.787; most accessible tissue: Minghui63 root, score: 91.22	N	N	N	N
vg0322395432	G -> A	LOC_Os03g40270-LOC_Os03g40290	intergenic_region ; MODIFIER	silent_mutation	Average:73.787; most accessible tissue: Minghui63 root, score: 91.22	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0322395432	G	A	0.13	0.11	0.04	0.03	0.15	0.14

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322395432	2.23E-07	1.73E-15	mr1871	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322395432	NA	3.77E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322395432	1.49E-07	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322395432	1.36E-06	1.79E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322395432	NA	2.11E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322395432	NA	1.84E-06	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322395432	NA	8.25E-09	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322395432	NA	1.08E-07	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322395432	4.03E-07	NA	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322395432	NA	2.34E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251