\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321614831:

Variant ID: vg0321614831 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21614831
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGCTGCCTCCACCACCGCATGGAGCCGCCAGTCCGCCACCTCCACCTCCCCCGTGAGGCGACGACACGCATGGCAATGGGAGGTGTGGAGGTGGATCT[G/A]
CCACCACCACCTCCACTGGGAGGCGATGAGATGGCCGGGAGGCGGCTCTGAAGAGGCCCGTGTCGTCTCCCTTTGCCAATGCAGTCATCGCACCTCCCCT

Reverse complement sequence

AGGGGAGGTGCGATGACTGCATTGGCAAAGGGAGACGACACGGGCCTCTTCAGAGCCGCCTCCCGGCCATCTCATCGCCTCCCAGTGGAGGTGGTGGTGG[C/T]
AGATCCACCTCCACACCTCCCATTGCCATGCGTGTCGTCGCCTCACGGGGGAGGTGGAGGTGGCGGACTGGCGGCTCCATGCGGTGGTGGAGGCAGCAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 11.20% 0.00% 0.00% NA
All Indica  2759 81.30% 18.70% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 36.80% 63.20% 0.00% 0.00% NA
Indica III  913 93.50% 6.50% 0.00% 0.00% NA
Indica Intermediate  786 79.90% 20.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321614831 G -> A LOC_Os03g38890.1 upstream_gene_variant ; 4833.0bp to feature; MODIFIER silent_mutation Average:69.411; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0321614831 G -> A LOC_Os03g38900.1 downstream_gene_variant ; 1761.0bp to feature; MODIFIER silent_mutation Average:69.411; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0321614831 G -> A LOC_Os03g38920.1 downstream_gene_variant ; 4321.0bp to feature; MODIFIER silent_mutation Average:69.411; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg0321614831 G -> A LOC_Os03g38900-LOC_Os03g38920 intergenic_region ; MODIFIER silent_mutation Average:69.411; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321614831 NA 1.80E-27 Grain_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321614831 NA 1.54E-27 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321614831 NA 2.50E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 4.20E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 8.96E-07 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 2.34E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 1.24E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 9.14E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 1.78E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 1.04E-14 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 7.56E-11 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 6.81E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 7.55E-11 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 3.15E-09 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 1.21E-07 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321614831 NA 1.49E-10 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251