\
| Variant ID: vg0321154919 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21154919 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )
GCTTATGCAATTACTCTATGTCATGACGATGATATTACTCTCGAAGTTCTTCCCGATGGGCAAAACCGACGCCCTTTGTGGACGAATTTCCAGTTTCCAG[C/T]
AGACAAGGGACGAGTCCATTCCGGAAGCATGGGAACTACTGCAGGAGTACGTGGCCGCCTGTCCTCATCATGGAATGGACGACTGGCTGATCTTGCAGAA
TTCTGCAAGATCAGCCAGTCGTCCATTCCATGATGAGGACAGGCGGCCACGTACTCCTGCAGTAGTTCCCATGCTTCCGGAATGGACTCGTCCCTTGTCT[G/A]
CTGGAAACTGGAAATTCGTCCACAAAGGGCGTCGGTTTTGCCCATCGGGAAGAACTTCGAGAGTAATATCATCGTCATGACATAGAGTAATTGCATAAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.20% | 42.80% | 0.78% | 0.15% | NA |
| All Indica | 2759 | 26.70% | 71.70% | 1.34% | 0.22% | NA |
| All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.80% | 23.20% | 0.67% | 0.34% | NA |
| Indica II | 465 | 9.70% | 87.10% | 2.80% | 0.43% | NA |
| Indica III | 913 | 7.30% | 91.50% | 0.99% | 0.22% | NA |
| Indica Intermediate | 786 | 22.30% | 76.30% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321154919 | C -> T | LOC_Os03g38100.1 | stop_gained ; p.Gln16*; HIGH | stop_gained | Average:48.689; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| vg0321154919 | C -> DEL | LOC_Os03g38100.1 | N | frameshift_variant | Average:48.689; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321154919 | NA | 1.54E-13 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0321154919 | NA | 7.52E-06 | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | NA | 2.82E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | NA | 5.87E-07 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | NA | 2.93E-06 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | NA | 8.44E-06 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | NA | 9.21E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | NA | 3.93E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | NA | 4.81E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | NA | 2.18E-08 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | NA | 9.63E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | NA | 2.26E-09 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | NA | 8.78E-07 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321154919 | 4.85E-06 | 4.85E-06 | mr1978 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |