\
| Variant ID: vg0321139464 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21139464 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )
TTGTGAACCACTGGGTCTAGTACCAGGGGGTACCGCCCCGGGTGGACCACTCGGTTAGGATGATCCGAGCGGTCAAACTTAATTGTTGTCTCTGACCATC[G/A]
AAGATATTGGGGCGTGTTGGGCTGAACAACATTGATCTCTCGTTCGGTCAGCTTTTGCTTTCTCTTGGATTCATAAGCTAGGGGTCCGCCAAAGATGTGG
CCACATCTTTGGCGGACCCCTAGCTTATGAATCCAAGAGAAAGCAAAAGCTGACCGAACGAGAGATCAATGTTGTTCAGCCCAACACGCCCCAATATCTT[C/T]
GATGGTCAGAGACAACAATTAAGTTTGACCGCTCGGATCATCCTAACCGAGTGGTCCACCCGGGGCGGTACCCCCTGGTACTAGACCCAGTGGTTCACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.30% | 44.40% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 25.90% | 73.80% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 1.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.30% | 24.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 7.50% | 91.80% | 0.65% | 0.00% | NA |
| Indica III | 913 | 7.00% | 93.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 21.20% | 78.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 4.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321139464 | G -> A | LOC_Os03g38082.1 | stop_gained ; p.Arg428*; HIGH | stop_gained | Average:50.706; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0321139464 | G -> A | LOC_Os03g38082.1 | stop_gained ; p.Arg428*; HIGH | nonsynonymous_codon ; R428W | Average:50.706; most accessible tissue: Minghui63 young leaf, score: 70.038 | benign |
0.875 |
DELETERIOUS | 0.02 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321139464 | NA | 6.99E-15 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0321139464 | NA | 1.39E-14 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0321139464 | NA | 2.37E-06 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0321139464 | NA | 2.94E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 1.97E-06 | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 1.77E-07 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 1.49E-06 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 6.40E-07 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 4.51E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 2.44E-11 | mr1637 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 2.59E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 2.59E-09 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 5.27E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 8.72E-10 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 2.72E-07 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 1.91E-09 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 1.82E-11 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | NA | 1.57E-10 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321139464 | 3.30E-06 | NA | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |