\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321124152:

Variant ID: vg0321124152 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 21124152
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTATCTGTGATTTATATTTTTTTAGTTTTTTAAAACAATTTAAAATAAGATGAACGATTAAAGTTAAACACGAAAAATCATGTATGCATTTATTTTGA[G/A]
ACGGATGGAGTATCAATTTGTGCCATCATCTTTTACTACGCCTCTCCATTATCTTTTACTCCATGACTTGACTGATAAGCCATGAAAATGAACGAAGGAA

Reverse complement sequence

TTCCTTCGTTCATTTTCATGGCTTATCAGTCAAGTCATGGAGTAAAAGATAATGGAGAGGCGTAGTAAAAGATGATGGCACAAATTGATACTCCATCCGT[C/T]
TCAAAATAAATGCATACATGATTTTTCGTGTTTAACTTTAATCGTTCATCTTATTTTAAATTGTTTTAAAAAACTAAAAAAATATAAATCACAGATAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 43.70% 0.19% 0.00% NA
All Indica  2759 26.60% 73.10% 0.33% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 75.60% 23.40% 1.01% 0.00% NA
Indica II  465 7.70% 92.00% 0.22% 0.00% NA
Indica III  913 8.00% 92.00% 0.00% 0.00% NA
Indica Intermediate  786 22.10% 77.60% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0321124152 G -> A LOC_Os03g38050.1 upstream_gene_variant ; 696.0bp to feature; MODIFIER silent_mutation Average:40.755; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N
vg0321124152 G -> A LOC_Os03g38050-LOC_Os03g38070 intergenic_region ; MODIFIER silent_mutation Average:40.755; most accessible tissue: Zhenshan97 flower, score: 66.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0321124152 NA 1.77E-17 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321124152 NA 9.04E-20 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321124152 NA 5.22E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 NA 4.98E-07 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 NA 7.22E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 NA 4.43E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 NA 2.87E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 NA 8.68E-09 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 NA 3.69E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 NA 1.76E-10 mr1804 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 NA 2.81E-08 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 NA 2.60E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 NA 1.20E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 NA 5.71E-11 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321124152 3.45E-06 NA mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251