Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321114139:

Variant ID: vg0321114139 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21114139
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

ACCAGTTGGAGGCCTGCGTCCTGACAACAATAATCTTTCCGGTGAATGTCGCTCGCGAACAGACCTACGTGCCACCTCAACACCGTTGAAATCAACGTGC[C/T]
CGTAGTCTTGGGTCAGCTAAGTTATTGGAGGAGGTTCATCAATCTGCGGTGGTCCTATCTCGTGTTGTGCTATTGACGACCCCCCACTGTAGCTACATGG

Reverse complement sequence

CCATGTAGCTACAGTGGGGGGTCGTCAATAGCACAACACGAGATAGGACCACCGCAGATTGATGAACCTCCTCCAATAACTTAGCTGACCCAAGACTACG[G/A]
GCACGTTGATTTCAACGGTGTTGAGGTGGCACGTAGGTCTGTTCGCGAGCGACATTCACCGGAAAGATTATTGTTGTCAGGACGCAGGCCTCCAACTGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.40%	35.20%	0.11%	0.30%	NA
All Indica	2759	47.20%	52.10%	0.18%	0.51%	NA
All Japonica	1512	98.60%	1.40%	0.00%	0.00%	NA
Aus	269	33.50%	66.50%	0.00%	0.00%	NA
Indica I	595	88.60%	11.10%	0.17%	0.17%	NA
Indica II	465	24.10%	75.50%	0.22%	0.22%	NA
Indica III	913	34.50%	64.50%	0.00%	0.99%	NA
Indica Intermediate	786	44.30%	55.00%	0.38%	0.38%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321114139	C -> T	LOC_Os03g38040.1	upstream_gene_variant ; 1796.0bp to feature; MODIFIER	silent_mutation	Average:54.551; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0321114139	C -> T	LOC_Os03g38020.1	downstream_gene_variant ; 1772.0bp to feature; MODIFIER	silent_mutation	Average:54.551; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0321114139	C -> T	LOC_Os03g38050.1	downstream_gene_variant ; 3747.0bp to feature; MODIFIER	silent_mutation	Average:54.551; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0321114139	C -> T	LOC_Os03g38020-LOC_Os03g38040	intergenic_region ; MODIFIER	silent_mutation	Average:54.551; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0321114139	C -> DEL	N	N	silent_mutation	Average:54.551; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321114139	NA	5.88E-15	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321114139	NA	5.21E-20	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0321114139	NA	4.04E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321114139	NA	8.71E-07	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321114139	NA	8.49E-07	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321114139	5.35E-07	NA	mr1750_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251