Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0319113443:

Variant ID: vg0319113443 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19113443
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGTGGGGAGGGGGAGAGAGGGGGATTCAAATCGAAACTCGCCCTTGCGGGCGCGGGTGTATGGGCGGGAACCGGGGGCGTGGGTGGTGACATGGGCAC[A/G]
GAGTGGGCGCGGGCGGCACGCGGCGGCGATTGGGATGGCGGTTGCCGCTGGTTGGAGGAAGGGGAAGGGGCTGCAGGCGGGCCCCATCCGTCAGCGCCCG

Reverse complement sequence

CGGGCGCTGACGGATGGGGCCCGCCTGCAGCCCCTTCCCCTTCCTCCAACCAGCGGCAACCGCCATCCCAATCGCCGCCGCGTGCCGCCCGCGCCCACTC[T/C]
GTGCCCATGTCACCACCCACGCCCCCGGTTCCCGCCCATACACCCGCGCCCGCAAGGGCGAGTTTCGATTTGAATCCCCCTCTCTCCCCCTCCCCACGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 10.80% 1.63% 14.16% NA
All Indica  2759 80.90% 0.60% 0.69% 17.80% NA
All Japonica  1512 53.20% 31.90% 3.64% 11.24% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.60% 0.30% 1.01% 4.03% NA
Indica II  465 76.60% 1.50% 0.22% 21.72% NA
Indica III  913 71.00% 0.10% 0.11% 28.81% NA
Indica Intermediate  786 84.70% 0.80% 1.40% 13.10% NA
Temperate Japonica  767 40.80% 54.00% 5.22% 0.00% NA
Tropical Japonica  504 64.30% 6.70% 0.20% 28.77% NA
Japonica Intermediate  241 69.70% 14.10% 5.81% 10.37% NA
VI/Aromatic  96 95.80% 1.00% 0.00% 3.12% NA
Intermediate  90 76.70% 14.40% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319113443 A -> DEL N N silent_mutation Average:47.295; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 N N N N
vg0319113443 A -> G LOC_Os03g33450.1 downstream_gene_variant ; 149.0bp to feature; MODIFIER silent_mutation Average:47.295; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 N N N N
vg0319113443 A -> G LOC_Os03g33460.1 downstream_gene_variant ; 715.0bp to feature; MODIFIER silent_mutation Average:47.295; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 N N N N
vg0319113443 A -> G LOC_Os03g33450-LOC_Os03g33460 intergenic_region ; MODIFIER silent_mutation Average:47.295; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0319113443 A G -0.01 -0.01 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319113443 NA 1.00E-09 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0319113443 NA 1.40E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 NA 3.31E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 NA 3.41E-06 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 5.60E-06 4.58E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 8.40E-06 8.40E-06 mr1245_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 1.02E-06 5.11E-09 mr1321_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 9.02E-06 2.22E-06 mr1321_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 3.09E-07 1.31E-09 mr1332_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 4.63E-06 1.91E-07 mr1332_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 4.36E-06 NA mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 NA 8.28E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 NA 6.96E-07 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 1.73E-06 NA mr1439_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 3.63E-06 NA mr1445_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 8.32E-06 4.00E-06 mr1499_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 3.52E-06 3.52E-06 mr1499_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 NA 1.53E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 NA 1.49E-07 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 2.79E-07 1.40E-08 mr1647_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 1.90E-06 1.90E-06 mr1647_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 2.02E-07 2.20E-09 mr1648_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319113443 NA 6.59E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251