Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0318995824:

Variant ID: vg0318995824 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18995824
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCGGGCGGTAGTACCGCCGCTGGGGCTTCGGCCTCTGCCGAAAGAATTGTCACGGCCGCGGCGAAAGTATTCGGCAGTCCTTCACGTCAGCCGGTTGC[G/A]
TCGCCGCTGATTGAGGCGAAGGGAAAGAGAGCGGTCGTTGAGACGTCCGCTTCGGAATATTCGCTCCCGTTACCCCGCTTCGCCCCTGGCGATTTCGAGA

Reverse complement sequence

TCTCGAAATCGCCAGGGGCGAAGCGGGGTAACGGGAGCGAATATTCCGAAGCGGACGTCTCAACGACCGCTCTCTTTCCCTTCGCCTCAATCAGCGGCGA[C/T]
GCAACCGGCTGACGTGAAGGACTGCCGAATACTTTCGCCGCGGCCGTGACAATTCTTTCGGCAGAGGCCGAAGCCCCAGCGGCGGTACTACCGCCCGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 6.40% 0.87% 0.59% NA
All Indica  2759 98.20% 0.10% 0.69% 1.01% NA
All Japonica  1512 79.00% 19.60% 1.39% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 99.10% 0.00% 0.43% 0.43% NA
Indica III  913 97.70% 0.20% 0.22% 1.86% NA
Indica Intermediate  786 97.20% 0.10% 1.53% 1.15% NA
Temperate Japonica  767 97.40% 2.10% 0.52% 0.00% NA
Tropical Japonica  504 54.60% 45.00% 0.40% 0.00% NA
Japonica Intermediate  241 71.80% 22.00% 6.22% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318995824 G -> A LOC_Os03g33220.1 synonymous_variant ; p.Ala505Ala; LOW synonymous_codon Average:51.01; most accessible tissue: Zhenshan97 flag leaf, score: 83.205 N N N N
vg0318995824 G -> DEL LOC_Os03g33220.1 N frameshift_variant Average:51.01; most accessible tissue: Zhenshan97 flag leaf, score: 83.205 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0318995824 G A -0.03 -0.03 -0.03 -0.03 -0.03 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318995824 9.27E-08 NA Grain_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0318995824 7.92E-06 NA Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652