\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317301896:

Variant ID: vg0317301896 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17301896
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


ACACTTTGTAATTGGATAACTGCCTATCACTTTTGTGATTTTGGAGAGCATGACTAAGTTGCATTACCCGAATATAATGCACCGGAGGAGGGTGAAATAC[C/T]
GAAGAATGCAAAGGTATACCTCATATTGTCTAGAGGCCTCGAGAAAAATAATGGGACAAGAACTCCGGCTCCTTAAATCCCTAAAGTAACTGGAGACGTC

Reverse complement sequence

GACGTCTCCAGTTACTTTAGGGATTTAAGGAGCCGGAGTTCTTGTCCCATTATTTTTCTCGAGGCCTCTAGACAATATGAGGTATACCTTTGCATTCTTC[G/A]
GTATTTCACCCTCCTCCGGTGCATTATATTCGGGTAATGCAACTTAGTCATGCTCTCCAAAATCACAAAAGTGATAGGCAGTTATCCAATTACAAAGTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 9.30% 1.02% 0.00% NA
All Indica  2759 99.10% 0.70% 0.14% 0.00% NA
All Japonica  1512 70.10% 27.30% 2.58% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.20% 0.70% 0.11% 0.00% NA
Indica Intermediate  786 98.30% 1.50% 0.13% 0.00% NA
Temperate Japonica  767 90.90% 7.00% 2.09% 0.00% NA
Tropical Japonica  504 47.80% 49.80% 2.38% 0.00% NA
Japonica Intermediate  241 50.60% 44.80% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 6.70% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317301896 C -> T LOC_Os03g30334.1 upstream_gene_variant ; 2420.0bp to feature; MODIFIER silent_mutation Average:47.036; most accessible tissue: Zhenshan97 root, score: 65.566 N N N N
vg0317301896 C -> T LOC_Os03g30320.1 downstream_gene_variant ; 2426.0bp to feature; MODIFIER silent_mutation Average:47.036; most accessible tissue: Zhenshan97 root, score: 65.566 N N N N
vg0317301896 C -> T LOC_Os03g30320-LOC_Os03g30334 intergenic_region ; MODIFIER silent_mutation Average:47.036; most accessible tissue: Zhenshan97 root, score: 65.566 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317301896 8.36E-06 NA Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317301896 NA 4.53E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317301896 NA 7.18E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 NA 6.47E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 NA 4.20E-08 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 5.39E-06 5.39E-06 mr1319 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 NA 6.21E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 NA 7.74E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 NA 2.07E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 NA 6.90E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 NA 1.35E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 6.62E-07 3.24E-16 mr1701 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 6.43E-06 6.43E-06 mr1701 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 NA 1.16E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 NA 2.34E-07 mr1786 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317301896 NA 1.95E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251