Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317107058:

Variant ID: vg0317107058 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17107058
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

TTATCTAACATTTGATAAATACAGAGCAATATTTGAAAAATACAGAACAAACGTAGGCGTGTGAACACTCATCCCTATCTATAAACGTACTACGCACATC[C/T]
TATCCCTATAAATATCTCTAGAAAACTGGTCGGCATATATTGAGATTCACGAAATCACTATAGGTGCATCGCTGTTGACCGATACATTGTCAAAGAACAA

Reverse complement sequence

TTGTTCTTTGACAATGTATCGGTCAACAGCGATGCACCTATAGTGATTTCGTGAATCTCAATATATGCCGACCAGTTTTCTAGAGATATTTATAGGGATA[G/A]
GATGTGCGTAGTACGTTTATAGATAGGGATGAGTGTTCACACGCCTACGTTTGTTCTGTATTTTTCAAATATTGCTCTGTATTTATCAAATGTTAGATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.90%	12.30%	0.76%	0.00%	NA
All Indica	2759	78.30%	20.50%	1.27%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	93.30%	3.00%	3.70%	0.00%	NA
Indica II	465	38.30%	59.80%	1.94%	0.00%	NA
Indica III	913	90.90%	9.00%	0.11%	0.00%	NA
Indica Intermediate	786	75.80%	23.80%	0.38%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317107058	C -> T	LOC_Os03g29990.1	upstream_gene_variant ; 790.0bp to feature; MODIFIER	silent_mutation	Average:62.805; most accessible tissue: Callus, score: 77.284	N	N	N	N
vg0317107058	C -> T	LOC_Os03g30000.1	downstream_gene_variant ; 2067.0bp to feature; MODIFIER	silent_mutation	Average:62.805; most accessible tissue: Callus, score: 77.284	N	N	N	N
vg0317107058	C -> T	LOC_Os03g29990-LOC_Os03g30000	intergenic_region ; MODIFIER	silent_mutation	Average:62.805; most accessible tissue: Callus, score: 77.284	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317107058	NA	3.20E-25	Grain_length	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317107058	2.55E-06	3.03E-24	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317107058	NA	3.64E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317107058	NA	3.02E-12	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317107058	NA	1.12E-08	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317107058	NA	2.85E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317107058	NA	1.23E-07	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317107058	NA	4.79E-06	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251