\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317014347:

Variant ID: vg0317014347 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17014347
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTCTTTTTGCCAGGTTGGCCACAGCCATTCTCTCTCTCGAGTATTTATCTCCTGATTACATGGACCGTTGGCCCAAACGATTTAAGGCACGCAGGCC[A/G]
CATTCTATTTGATAAAGTTTAGCCCAAAACACACACACTATCATTCACAGTTAAACCTCTTTCTCAGTGTCACCATTGCCGGTCATGACAGTGCCGCCCG

Reverse complement sequence

CGGGCGGCACTGTCATGACCGGCAATGGTGACACTGAGAAAGAGGTTTAACTGTGAATGATAGTGTGTGTGTTTTGGGCTAAACTTTATCAAATAGAATG[T/C]
GGCCTGCGTGCCTTAAATCGTTTGGGCCAACGGTCCATGTAATCAGGAGATAAATACTCGAGAGAGAGAATGGCTGTGGCCAACCTGGCAAAAAGAAATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 37.20% 5.12% 8.53% NA
All Indica  2759 35.30% 47.30% 3.62% 13.74% NA
All Japonica  1512 84.80% 11.20% 4.03% 0.00% NA
Aus  269 1.10% 92.20% 1.49% 5.20% NA
Indica I  595 6.20% 50.40% 7.06% 36.30% NA
Indica II  465 74.60% 21.70% 0.86% 2.80% NA
Indica III  913 31.10% 56.40% 2.74% 9.75% NA
Indica Intermediate  786 38.90% 49.60% 3.69% 7.76% NA
Temperate Japonica  767 78.50% 20.70% 0.78% 0.00% NA
Tropical Japonica  504 89.10% 0.60% 10.32% 0.00% NA
Japonica Intermediate  241 95.90% 2.90% 1.24% 0.00% NA
VI/Aromatic  96 10.40% 12.50% 71.88% 5.21% NA
Intermediate  90 58.90% 26.70% 8.89% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317014347 A -> DEL N N silent_mutation Average:39.153; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0317014347 A -> G LOC_Os03g29850.1 upstream_gene_variant ; 3084.0bp to feature; MODIFIER silent_mutation Average:39.153; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0317014347 A -> G LOC_Os03g29864.1 downstream_gene_variant ; 51.0bp to feature; MODIFIER silent_mutation Average:39.153; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0317014347 A -> G LOC_Os03g29850-LOC_Os03g29864 intergenic_region ; MODIFIER silent_mutation Average:39.153; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317014347 NA 5.02E-17 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317014347 NA 7.38E-31 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317014347 NA 5.52E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317014347 NA 1.72E-06 Grain_weight Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317014347 NA 4.91E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 3.30E-15 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 4.12E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 1.89E-06 1.89E-06 mr1198 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 2.30E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 9.26E-08 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 2.16E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 3.50E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 2.07E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 8.26E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 7.45E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 2.49E-07 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 7.63E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 8.73E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 5.63E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 6.76E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 3.64E-07 3.63E-07 mr1597 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 2.00E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 1.39E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 3.63E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 2.48E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 1.41E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 4.01E-09 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 4.60E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 6.83E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 6.70E-17 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 9.31E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 4.15E-06 NA mr1896 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 1.34E-11 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 7.69E-07 mr1897 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 5.12E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 1.09E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 3.68E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317014347 NA 4.07E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251