\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317009509:

Variant ID: vg0317009509 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17009509
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AGACATATGTACGGGCCATTTAAATTCCAAGCTGAAAGCGAGTGTTAATTAAGTCGAGCAGGCAGGGACAACCGGACAAGAGACTAACGGACAAGGTCAC[G/A]
AGGTCTCTCTATATATATACTCTCTCCGTCATGCCGTTGACTTTTTTAAACATGTTTGACCGTTCATCTTATTCAGAAAATTTAAGTAATTTTTAATTCT

Reverse complement sequence

AGAATTAAAAATTACTTAAATTTTCTGAATAAGATGAACGGTCAAACATGTTTAAAAAAGTCAACGGCATGACGGAGAGAGTATATATATAGAGAGACCT[C/T]
GTGACCTTGTCCGTTAGTCTCTTGTCCGGTTGTCCCTGCCTGCTCGACTTAATTAACACTCGCTTTCAGCTTGGAATTTAAATGGCCCGTACATATGTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 48.30% 0.19% 0.00% NA
All Indica  2759 65.20% 34.70% 0.11% 0.00% NA
All Japonica  1512 16.10% 83.50% 0.40% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 95.50% 4.40% 0.17% 0.00% NA
Indica II  465 25.60% 74.40% 0.00% 0.00% NA
Indica III  913 68.70% 31.30% 0.00% 0.00% NA
Indica Intermediate  786 61.70% 38.00% 0.25% 0.00% NA
Temperate Japonica  767 22.90% 76.30% 0.78% 0.00% NA
Tropical Japonica  504 11.50% 88.50% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317009509 G -> A LOC_Os03g29864.1 downstream_gene_variant ; 4889.0bp to feature; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 root, score: 97.442 N N N N
vg0317009509 G -> A LOC_Os03g29850.1 intron_variant ; MODIFIER silent_mutation Average:91.619; most accessible tissue: Minghui63 root, score: 97.442 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0317009509 G A 0.0 -0.01 -0.01 -0.03 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317009509 NA 7.86E-19 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317009509 NA 5.97E-32 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317009509 NA 4.93E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 3.70E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 1.50E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 1.29E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 7.87E-06 mr1297 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 7.70E-06 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 3.73E-07 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 1.29E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 1.21E-07 1.21E-07 mr1597 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 2.01E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 8.23E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 2.24E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 7.15E-08 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 9.57E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 4.38E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317009509 NA 5.01E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251