\
| Variant ID: vg0317005591 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 17005591 |
| Reference Allele: T | Alternative Allele: C,TGTGACCCACCTATGTGACCCCGGAGACTTGTTACCTGGCCTCTCC |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.63, C: 0.37, others allele: 0.00, population size: 94. )
AAGACTTGTTACCTGGTCTCTCCACCATGTGACCCGGGTTCCACCTTTTAAGTCGTCACATCAACCTATGTGACCCCGGAGACTTGTTACCTGGCCTCTC[T/C,TGTGACCCACCTATGTGACCCCGGAGACTTGTTACCTGGCCTCTCC]
ACCATGTGACCCATGGAAATTGTTCCGGGTTCCAAACCTTGGGCTCTGATACCCACTTGTTAGAGTGCGCAGCCCGGCCCACCAACCGTGGGCCACAACT
AGTTGTGGCCCACGGTTGGTGGGCCGGGCTGCGCACTCTAACAAGTGGGTATCAGAGCCCAAGGTTTGGAACCCGGAACAATTTCCATGGGTCACATGGT[A/G,GGAGAGGCCAGGTAACAAGTCTCCGGGGTCACATAGGTGGGTCACA]
GAGAGGCCAGGTAACAAGTCTCCGGGGTCACATAGGTTGATGTGACGACTTAAAAGGTGGAACCCGGGTCACATGGTGGAGAGACCAGGTAACAAGTCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.30% | 42.20% | 1.27% | 4.23% | TGTGACCCACCTATGTGACCCCGGAGACTTGTTACCTGGCCTCTCC: 0.02% |
| All Indica | 2759 | 34.50% | 56.20% | 2.07% | 7.21% | NA |
| All Japonica | 1512 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 4.40% | 60.00% | 7.06% | 28.57% | NA |
| Indica II | 465 | 74.00% | 25.60% | 0.43% | 0.00% | NA |
| Indica III | 913 | 31.00% | 67.90% | 0.55% | 0.55% | NA |
| Indica Intermediate | 786 | 38.20% | 57.80% | 1.02% | 3.05% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 35.60% | 3.33% | 1.11% | TGTGACCCACCTATGTGACCCCGGAGACTTGTTACCTGGCCTCTCC: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317005591 | T -> C | LOC_Os03g29830.1 | downstream_gene_variant ; 3279.0bp to feature; MODIFIER | silent_mutation | Average:72.245; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0317005591 | T -> C | LOC_Os03g29850.1 | downstream_gene_variant ; 2364.0bp to feature; MODIFIER | silent_mutation | Average:72.245; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0317005591 | T -> C | LOC_Os03g29830-LOC_Os03g29850 | intergenic_region ; MODIFIER | silent_mutation | Average:72.245; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0317005591 | T -> DEL | N | N | silent_mutation | Average:72.245; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0317005591 | T -> TGTGACCCACCTATGTGACCCCGGAGACTT GTTACCTGGCCTCTCC | LOC_Os03g29830.1 | downstream_gene_variant ; 3280.0bp to feature; MODIFIER | silent_mutation | Average:72.245; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0317005591 | T -> TGTGACCCACCTATGTGACCCCGGAGACTT GTTACCTGGCCTCTCC | LOC_Os03g29850.1 | downstream_gene_variant ; 2363.0bp to feature; MODIFIER | silent_mutation | Average:72.245; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0317005591 | T -> TGTGACCCACCTATGTGACCCCGGAGACTT GTTACCTGGCCTCTCC | LOC_Os03g29830-LOC_Os03g29850 | intergenic_region ; MODIFIER | silent_mutation | Average:72.245; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317005591 | 5.60E-09 | NA | Grain_length | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0317005591 | 2.13E-07 | 2.48E-33 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0317005591 | NA | 4.86E-12 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0317005591 | NA | 6.19E-07 | Grain_weight | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0317005591 | NA | 6.25E-15 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 4.73E-15 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 9.03E-16 | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 7.73E-08 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 2.54E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 2.66E-10 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 7.66E-09 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 5.85E-07 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 6.64E-09 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 4.34E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 9.40E-15 | mr1675 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 1.39E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 1.56E-08 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317005591 | NA | 1.85E-15 | mr1969 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |