Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316905224:

Variant ID: vg0316905224 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16905224
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTCAGGACTATCACCAGCCAAGCCTCAGCATTGCCGGCGCCGGATCTAGTCGCAGGAGCAGGGGACATGATGAACGATCTGTTCGTTCGCCTCCCGAA[T/C]
GATATAGGGAGCGTCGAGTTGAACGTCCACACTCCCCACATCGAAGGCGCCCCGTCGATCTTCGTGACACCATCAACCAGCTCCGCGCAGCAAGAGGCAA

Reverse complement sequence

TTGCCTCTTGCTGCGCGGAGCTGGTTGATGGTGTCACGAAGATCGACGGGGCGCCTTCGATGTGGGGAGTGTGGACGTTCAACTCGACGCTCCCTATATC[A/G]
TTCGGGAGGCGAACGAACAGATCGTTCATCATGTCCCCTGCTCCTGCGACTAGATCCGGCGCCGGCAATGCTGAGGCTTGGCTGGTGATAGTCCTGAGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	45.60%	1.44%	0.53%	NA
All Indica	2759	34.10%	62.70%	2.25%	0.91%	NA
All Japonica	1512	96.00%	4.00%	0.00%	0.00%	NA
Aus	269	8.20%	91.10%	0.74%	0.00%	NA
Indica I	595	5.00%	93.60%	1.18%	0.17%	NA
Indica II	465	79.80%	16.10%	2.58%	1.51%	NA
Indica III	913	26.80%	68.70%	3.50%	0.99%	NA
Indica Intermediate	786	37.70%	59.90%	1.40%	1.02%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	88.90%	11.10%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	58.90%	36.70%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316905224	T -> C	LOC_Os03g29650.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:69.017; most accessible tissue: Zhenshan97 flag leaf, score: 84.998	N	N	N	N
vg0316905224	T -> DEL	N	N	silent_mutation	Average:69.017; most accessible tissue: Zhenshan97 flag leaf, score: 84.998	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316905224	4.99E-09	5.78E-14	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316905224	8.35E-08	1.51E-36	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316905224	NA	2.98E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316905224	NA	9.95E-06	Grain_weight	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316905224	NA	1.35E-10	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316905224	NA	2.63E-08	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	1.15E-08	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	3.29E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	7.65E-06	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	6.85E-09	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	9.42E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	4.69E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	1.63E-06	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	1.66E-10	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	3.36E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	1.12E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	4.44E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	5.27E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	5.77E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	4.19E-09	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	6.41E-06	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	5.58E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316905224	NA	9.88E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251