Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316845802:

Variant ID: vg0316845802 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16845802
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

CCCCTCAAACCATGCCAAAAGGATGAATTATGCCCAATTCACCACTAAGAAAAGCAAAGCGATTAGAATCCAAAGGTTTAGAGAAAATATCAGCAATTTG[C/T]
AACTTTGTATCCAAAAACTGCAATTCAACATCTCCTTTCTCAACATGATCCCTCAAAAAGTGAAAACGAATATCAATGTGCTTTGTGCGTGAGTGTTGAA

Reverse complement sequence

TTCAACACTCACGCACAAAGCACATTGATATTCGTTTTCACTTTTTGAGGGATCATGTTGAGAAAGGAGATGTTGAATTGCAGTTTTTGGATACAAAGTT[G/A]
CAAATTGCTGATATTTTCTCTAAACCTTTGGATTCTAATCGCTTTGCTTTTCTTAGTGGTGAATTGGGCATAATTCATCCTTTTGGCATGGTTTGAGGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.60%	17.20%	1.86%	1.33%	NA
All Indica	2759	68.90%	28.70%	2.28%	0.11%	NA
All Japonica	1512	99.10%	0.30%	0.46%	0.20%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	97.30%	2.40%	0.34%	0.00%	NA
Indica II	465	23.40%	69.00%	7.53%	0.00%	NA
Indica III	913	72.80%	26.00%	0.88%	0.33%	NA
Indica Intermediate	786	69.80%	27.90%	2.29%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	0.40%	0.60%	0.00%	NA
Japonica Intermediate	241	96.70%	0.40%	1.66%	1.24%	NA
VI/Aromatic	96	26.00%	2.10%	16.67%	55.21%	NA
Intermediate	90	76.70%	17.80%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316845802	C -> T	LOC_Os03g29560.1	synonymous_variant ; p.Leu1040Leu; LOW	synonymous_codon	Average:20.691; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg0316845802	C -> DEL	LOC_Os03g29560.1	N	frameshift_variant	Average:20.691; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316845802	4.49E-08	3.24E-37	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316845802	1.42E-10	4.32E-47	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316845802	NA	4.92E-18	Grain_width	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316845802	NA	1.12E-13	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	2.36E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	4.04E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	2.45E-07	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	4.89E-07	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	1.28E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	1.09E-13	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	9.92E-08	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	1.19E-08	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	5.51E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	3.43E-07	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	2.07E-07	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	7.22E-09	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	7.16E-07	mr1931	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	9.08E-09	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	1.00E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	1.86E-06	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	2.77E-06	mr1976	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	5.80E-06	mr1042_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	3.94E-09	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	2.83E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	1.32E-07	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	1.27E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	3.91E-07	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	2.98E-07	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316845802	NA	6.76E-06	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251