Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316733441:

Variant ID: vg0316733441 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16733441
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

AACTGGGGTAAGTAAGTATATTTTGTGAATGCATGGTAAGAGTAAAGACGAGAAGAAATGGAAGTAGTACAAAAAGAAACAGCAGGCTGGCTTACTCTCT[G/T]
CAGCATCTGGAGGCAGCGTGGATCCCTTCGATTGAATTTATTTCACCCTGCAAGAAATATATATACAGTTGTTTGTTCGAATTAATTTAAGTAAACGAGG

Reverse complement sequence

CCTCGTTTACTTAAATTAATTCGAACAAACAACTGTATATATATTTCTTGCAGGGTGAAATAAATTCAATCGAAGGGATCCACGCTGCCTCCAGATGCTG[C/A]
AGAGAGTAAGCCAGCCTGCTGTTTCTTTTTGTACTACTTCCATTTCTTCTCGTCTTTACTCTTACCATGCATTCACAAAATATACTTACTTACCCCAGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.70%	33.40%	1.95%	0.00%	NA
All Indica	2759	64.30%	33.90%	1.74%	0.00%	NA
All Japonica	1512	59.00%	38.30%	2.71%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.30%	4.00%	0.67%	0.00%	NA
Indica II	465	20.60%	73.80%	5.59%	0.00%	NA
Indica III	913	65.70%	34.00%	0.33%	0.00%	NA
Indica Intermediate	786	65.10%	33.00%	1.91%	0.00%	NA
Temperate Japonica	767	90.10%	7.30%	2.61%	0.00%	NA
Tropical Japonica	504	24.40%	73.60%	1.98%	0.00%	NA
Japonica Intermediate	241	32.40%	63.10%	4.56%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	58.90%	37.80%	3.33%	0.00%	NA

QTN in RiceNavi

Rice quantitative trait nucleotides (QTNs) and inferred QTN effects are from Wei et al., Nature Genetics, 2021.

Category	Variant ID	Chrom	Pos	Gene	MSU	RAP	Alt_Allele_Function	Ref_geno	Alt_geno
Yield components	vg0316733441	Chr3	16733441	GS3	nan	Os03g0407400	increasing grain length	G	T

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316733441	G -> T	LOC_Os03g29370-LOC_Os03g29389	intergenic_region ; MODIFIER	silent_mutation	Average:54.446; most accessible tissue: Callus, score: 84.91	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316733441	2.98E-22	4.38E-75	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316733441	2.93E-12	6.98E-51	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316733441	9.80E-08	2.32E-21	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316733441	NA	1.70E-16	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316733441	NA	1.03E-06	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	8.10E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	4.34E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	5.23E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	4.25E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	2.38E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	2.97E-07	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	8.33E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	1.90E-08	mr1727	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	6.19E-06	mr1727	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	6.52E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	1.42E-06	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	4.99E-07	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	6.16E-07	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	1.28E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	1.19E-06	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	2.05E-06	mr1975	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	1.31E-06	mr1976	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	2.36E-07	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	1.13E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	7.78E-06	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316733441	NA	4.51E-07	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251