\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316706516:

Variant ID: vg0316706516 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16706516
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ACTACACAGCTAGTGGAACATCTATAAGAGGCATTATCCACCTATACTTCAAATACAATTTTCTCTTAAACTACTCATCCGATATACGATCCGATTACAC[C/T]
GTTGTGTTCGTAACAATTAAATCTTTACAACAATATCTCACATGATTATATTTTGATGAAAATCACAAATTACTTTTATGATATGTCTAAATTACTTTTA

Reverse complement sequence

TAAAAGTAATTTAGACATATCATAAAAGTAATTTGTGATTTTCATCAAAATATAATCATGTGAGATATTGTTGTAAAGATTTAATTGTTACGAACACAAC[G/A]
GTGTAATCGGATCGTATATCGGATGAGTAGTTTAAGAGAAAATTGTATTTGAAGTATAGGTGGATAATGCCTCTTATAGATGTTCCACTAGCTGTGTAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 34.40% 1.46% 0.00% NA
All Indica  2759 65.00% 33.80% 1.27% 0.00% NA
All Japonica  1512 59.70% 38.20% 2.18% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.80% 2.90% 1.34% 0.00% NA
Indica II  465 22.40% 74.60% 3.01% 0.00% NA
Indica III  913 65.80% 33.70% 0.44% 0.00% NA
Indica Intermediate  786 65.80% 33.10% 1.15% 0.00% NA
Temperate Japonica  767 90.60% 8.00% 1.43% 0.00% NA
Tropical Japonica  504 27.20% 71.40% 1.39% 0.00% NA
Japonica Intermediate  241 29.00% 64.70% 6.22% 0.00% NA
VI/Aromatic  96 17.70% 81.20% 1.04% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316706516 C -> T LOC_Os03g29350.1 upstream_gene_variant ; 1899.0bp to feature; MODIFIER silent_mutation Average:57.657; most accessible tissue: Zhenshan97 root, score: 91.92 N N N N
vg0316706516 C -> T LOC_Os03g29350.2 upstream_gene_variant ; 1899.0bp to feature; MODIFIER silent_mutation Average:57.657; most accessible tissue: Zhenshan97 root, score: 91.92 N N N N
vg0316706516 C -> T LOC_Os03g29350.4 upstream_gene_variant ; 1899.0bp to feature; MODIFIER silent_mutation Average:57.657; most accessible tissue: Zhenshan97 root, score: 91.92 N N N N
vg0316706516 C -> T LOC_Os03g29350-LOC_Os03g29360 intergenic_region ; MODIFIER silent_mutation Average:57.657; most accessible tissue: Zhenshan97 root, score: 91.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316706516 1.59E-23 6.65E-76 Grain_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316706516 1.37E-13 3.77E-52 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316706516 1.92E-09 2.28E-24 Grain_length Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316706516 3.42E-08 NA Grain_weight All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316706516 NA 4.17E-07 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316706516 NA 1.07E-14 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316706516 NA 8.11E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 1.75E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 1.23E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 3.55E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 9.11E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 3.35E-07 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 5.30E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 7.58E-11 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 1.19E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 6.34E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 2.74E-07 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 5.77E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 6.66E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 6.97E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 5.76E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 6.04E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 7.40E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316706516 NA 6.92E-07 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251