\
| Variant ID: vg0316706516 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16706516 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 113. )
ACTACACAGCTAGTGGAACATCTATAAGAGGCATTATCCACCTATACTTCAAATACAATTTTCTCTTAAACTACTCATCCGATATACGATCCGATTACAC[C/T]
GTTGTGTTCGTAACAATTAAATCTTTACAACAATATCTCACATGATTATATTTTGATGAAAATCACAAATTACTTTTATGATATGTCTAAATTACTTTTA
TAAAAGTAATTTAGACATATCATAAAAGTAATTTGTGATTTTCATCAAAATATAATCATGTGAGATATTGTTGTAAAGATTTAATTGTTACGAACACAAC[G/A]
GTGTAATCGGATCGTATATCGGATGAGTAGTTTAAGAGAAAATTGTATTTGAAGTATAGGTGGATAATGCCTCTTATAGATGTTCCACTAGCTGTGTAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 34.40% | 1.46% | 0.00% | NA |
| All Indica | 2759 | 65.00% | 33.80% | 1.27% | 0.00% | NA |
| All Japonica | 1512 | 59.70% | 38.20% | 2.18% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 2.90% | 1.34% | 0.00% | NA |
| Indica II | 465 | 22.40% | 74.60% | 3.01% | 0.00% | NA |
| Indica III | 913 | 65.80% | 33.70% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 65.80% | 33.10% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 90.60% | 8.00% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 27.20% | 71.40% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.00% | 64.70% | 6.22% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 81.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316706516 | C -> T | LOC_Os03g29350.1 | upstream_gene_variant ; 1899.0bp to feature; MODIFIER | silent_mutation | Average:57.657; most accessible tissue: Zhenshan97 root, score: 91.92 | N | N | N | N |
| vg0316706516 | C -> T | LOC_Os03g29350.2 | upstream_gene_variant ; 1899.0bp to feature; MODIFIER | silent_mutation | Average:57.657; most accessible tissue: Zhenshan97 root, score: 91.92 | N | N | N | N |
| vg0316706516 | C -> T | LOC_Os03g29350.4 | upstream_gene_variant ; 1899.0bp to feature; MODIFIER | silent_mutation | Average:57.657; most accessible tissue: Zhenshan97 root, score: 91.92 | N | N | N | N |
| vg0316706516 | C -> T | LOC_Os03g29350-LOC_Os03g29360 | intergenic_region ; MODIFIER | silent_mutation | Average:57.657; most accessible tissue: Zhenshan97 root, score: 91.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316706516 | 1.59E-23 | 6.65E-76 | Grain_length | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0316706516 | 1.37E-13 | 3.77E-52 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0316706516 | 1.92E-09 | 2.28E-24 | Grain_length | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0316706516 | 3.42E-08 | NA | Grain_weight | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0316706516 | NA | 4.17E-07 | Grain_weight | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0316706516 | NA | 1.07E-14 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0316706516 | NA | 8.11E-06 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 1.75E-06 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 1.23E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 3.55E-06 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 9.11E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 3.35E-07 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 5.30E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 7.58E-11 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 1.19E-06 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 6.34E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 2.74E-07 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 5.77E-06 | mr1942 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 6.66E-08 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 6.97E-06 | mr1975 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 5.76E-06 | mr1976 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 6.04E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 7.40E-06 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316706516 | NA | 6.92E-07 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |