\
| Variant ID: vg0316684121 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16684121 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 99. )
CTTACATTCCTGGGATCCTTAGAAAATTATGGGTGTTTTGCATCAAATGTCTTCCACTGGCGAGCATCGGCGAGATGTCGAATCATACCATCTATCTTCC[A/G]
GCTCTCTTGATGCCATCTCATCAACTCAGCATCAGTCGGGTTTGAGTACAGGCGCTTCAGGCGGTCCTTAATTGGTAGGTACCACATCACCATTGAGGGA
TCCCTCAATGGTGATGTGGTACCTACCAATTAAGGACCGCCTGAAGCGCCTGTACTCAAACCCGACTGATGCTGAGTTGATGAGATGGCATCAAGAGAGC[T/C]
GGAAGATAGATGGTATGATTCGACATCTCGCCGATGCTCGCCAGTGGAAGACATTTGATGCAAAACACCCATAATTTTCTAAGGATCCCAGGAATGTAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 32.80% | 8.08% | 1.10% | NA |
| All Indica | 2759 | 41.00% | 46.40% | 11.42% | 1.27% | NA |
| All Japonica | 1512 | 90.90% | 4.20% | 4.03% | 0.79% | NA |
| Aus | 269 | 29.40% | 70.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 12.90% | 67.70% | 18.32% | 1.01% | NA |
| Indica II | 465 | 84.10% | 13.10% | 2.58% | 0.22% | NA |
| Indica III | 913 | 37.30% | 49.80% | 10.84% | 1.97% | NA |
| Indica Intermediate | 786 | 40.80% | 45.80% | 12.09% | 1.27% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 74.80% | 12.10% | 11.51% | 1.59% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.80% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 2.08% | 3.12% | NA |
| Intermediate | 90 | 73.30% | 20.00% | 4.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316684121 | A -> DEL | LOC_Os03g29310.1 | N | frameshift_variant | Average:36.864; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0316684121 | A -> G | LOC_Os03g29310.1 | missense_variant ; p.Trp186Arg; MODERATE | nonsynonymous_codon ; W186R | Average:36.864; most accessible tissue: Minghui63 flag leaf, score: 50.629 | benign |
-0.417 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316684121 | 1.82E-14 | 7.04E-18 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0316684121 | 2.12E-15 | 2.78E-52 | Grain_length | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0316684121 | NA | 9.53E-16 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0316684121 | NA | 1.61E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316684121 | NA | 9.92E-07 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316684121 | NA | 5.24E-10 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316684121 | NA | 7.70E-07 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316684121 | NA | 9.36E-07 | mr1727 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316684121 | NA | 4.57E-07 | mr1942 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316684121 | NA | 2.76E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316684121 | NA | 3.27E-06 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316684121 | NA | 5.78E-06 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316684121 | NA | 9.33E-06 | mr1739_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316684121 | NA | 2.86E-07 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |