\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315004688:

Variant ID: vg0315004688 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 15004688
Reference Allele: AAlternative Allele: T,AT,AAT
Primary Allele: ASecondary Allele: AT

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGTTCCGGAGTATAGGTAGCAATCAACTAAGAAATCCTCTGCAATTTGATACCCATCTTATCATAAGCCCTCCTAAATACATTTAGTTTGGTAAAAAA[A/T,AT,AAT]
ATTCTTTTCAGAAAGACAATACAAATATTGATGCTCACAGAAGCGCGCACAACCACCTCTATGAACGTACATTCGGAAAACTCATCCGACATACGTTGAC

Reverse complement sequence

GTCAACGTATGTCGGATGAGTTTTCCGAATGTACGTTCATAGAGGTGGTTGTGCGCGCTTCTGTGAGCATCAATATTTGTATTGTCTTTCTGAAAAGAAT[T/A,AT,ATT]
TTTTTTACCAAACTAAATGTATTTAGGAGGGCTTATGATAAGATGGGTATCAAATTGCAGAGGATTTCTTAGTTGATTGCTACCTATACTCCGGAACAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 21.00% 0.42% 0.04% T: 15.72%; AAT: 4.68%
All Indica  2759 70.60% 27.90% 0.51% 0.07% AAT: 0.87%; T: 0.11%
All Japonica  1512 43.30% 7.50% 0.20% 0.00% T: 48.21%; AAT: 0.86%
Aus  269 1.50% 33.50% 0.37% 0.00% AAT: 64.68%
Indica I  595 46.10% 53.60% 0.34% 0.00% NA
Indica II  465 50.50% 48.20% 0.86% 0.00% T: 0.43%
Indica III  913 88.90% 10.00% 0.33% 0.11% AAT: 0.55%; T: 0.11%
Indica Intermediate  786 79.60% 17.20% 0.64% 0.13% AAT: 2.42%
Temperate Japonica  767 17.50% 0.40% 0.13% 0.00% T: 82.01%
Tropical Japonica  504 64.10% 19.80% 0.40% 0.00% T: 13.29%; AAT: 2.38%
Japonica Intermediate  241 81.70% 4.10% 0.00% 0.00% T: 13.69%; AAT: 0.41%
VI/Aromatic  96 91.70% 1.00% 1.04% 0.00% AAT: 5.21%; T: 1.04%
Intermediate  90 58.90% 23.30% 1.11% 0.00% T: 11.11%; AAT: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315004688 A -> T LOC_Os03g26220.1 upstream_gene_variant ; 125.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> T LOC_Os03g26229.1 upstream_gene_variant ; 1207.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> T LOC_Os03g26210.1 downstream_gene_variant ; 2483.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> T LOC_Os03g26240.1 downstream_gene_variant ; 4067.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> T LOC_Os03g26210.3 downstream_gene_variant ; 2483.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> T LOC_Os03g26210.2 downstream_gene_variant ; 2483.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> T LOC_Os03g26220-LOC_Os03g26229 intergenic_region ; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AAT LOC_Os03g26220.1 upstream_gene_variant ; 126.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AAT LOC_Os03g26229.1 upstream_gene_variant ; 1206.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AAT LOC_Os03g26210.1 downstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AAT LOC_Os03g26240.1 downstream_gene_variant ; 4066.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AAT LOC_Os03g26210.3 downstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AAT LOC_Os03g26210.2 downstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AAT LOC_Os03g26220-LOC_Os03g26229 intergenic_region ; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> DEL N N silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AT LOC_Os03g26220.1 upstream_gene_variant ; 126.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AT LOC_Os03g26229.1 upstream_gene_variant ; 1206.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AT LOC_Os03g26210.1 downstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AT LOC_Os03g26240.1 downstream_gene_variant ; 4066.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AT LOC_Os03g26210.3 downstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AT LOC_Os03g26210.2 downstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0315004688 A -> AT LOC_Os03g26220-LOC_Os03g26229 intergenic_region ; MODIFIER silent_mutation Average:93.485; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315004688 A AAT 0.22 0.16 0.13 0.08 0.14 0.14
vg0315004688 A AT 0.06 0.05 0.07 0.0 0.04 0.04
vg0315004688 A T 0.01 0.01 0.0 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315004688 NA 1.29E-09 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0315004688 NA 1.47E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0315004688 NA 7.82E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 3.37E-08 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 2.88E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 1.81E-07 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 1.03E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 6.58E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 4.44E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 1.40E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 2.23E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 2.07E-06 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 1.95E-10 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 8.63E-08 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 4.24E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 7.40E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 1.95E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 6.70E-09 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 9.35E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 7.89E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 4.98E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 8.45E-08 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 9.86E-07 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 5.21E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 6.39E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 9.94E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 3.62E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 2.22E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 1.19E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 5.04E-10 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 3.41E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 9.54E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 6.18E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 2.85E-06 NA mr1793 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 6.56E-06 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 7.89E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 7.76E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 7.03E-14 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 7.36E-07 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 7.44E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 1.36E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 7.85E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315004688 NA 1.10E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251