\
| Variant ID: vg0314815996 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14815996 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 254. )
TATAATTCATAATTTGTTGTAGATCTATGTGTTTGTGTGTTCTAAGTTAGTTCTTCACAGGTGGCCCATTGGTCCATCCCTTGGCCAATGTTTACACAGG[C/T]
GGGTTCTACTTTCAACTCGCCTGTGTCATAAATGGGGTATAGGAAAAACACATTATTGTATGATTGGATTTTTTTTTCGATTAATTTGGATGTGTTGTTT
AAACAACACATCCAAATTAATCGAAAAAAAAATCCAATCATACAATAATGTGTTTTTCCTATACCCCATTTATGACACAGGCGAGTTGAAAGTAGAACCC[G/A]
CCTGTGTAAACATTGGCCAAGGGATGGACCAATGGGCCACCTGTGAAGAACTAACTTAGAACACACAAACACATAGATCTACAACAAATTATGAATTATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.90% | 7.00% | 0.02% | 21.10% | NA |
| All Indica | 2759 | 74.70% | 0.00% | 0.00% | 25.30% | NA |
| All Japonica | 1512 | 79.40% | 19.60% | 0.00% | 0.93% | NA |
| Aus | 269 | 3.70% | 0.40% | 0.37% | 95.54% | NA |
| Indica I | 595 | 52.10% | 0.00% | 0.00% | 47.90% | NA |
| Indica II | 465 | 61.30% | 0.00% | 0.00% | 38.71% | NA |
| Indica III | 913 | 90.70% | 0.00% | 0.00% | 9.31% | NA |
| Indica Intermediate | 786 | 81.20% | 0.00% | 0.00% | 18.83% | NA |
| Temperate Japonica | 767 | 96.70% | 3.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 55.00% | 43.10% | 0.00% | 1.98% | NA |
| Japonica Intermediate | 241 | 75.50% | 23.20% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 70.80% | 24.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 65.60% | 8.90% | 0.00% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314815996 | C -> T | LOC_Os03g25890-LOC_Os03g25900 | intergenic_region ; MODIFIER | silent_mutation | Average:60.124; most accessible tissue: Callus, score: 82.786 | N | N | N | N |
| vg0314815996 | C -> DEL | N | N | silent_mutation | Average:60.124; most accessible tissue: Callus, score: 82.786 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314815996 | 1.32E-09 | NA | Grain_length | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0314815996 | 1.65E-06 | 5.50E-18 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0314815996 | NA | 8.66E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 6.93E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 2.33E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 3.74E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 5.37E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 5.81E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 2.63E-10 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 4.38E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 3.35E-09 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 3.27E-08 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 1.46E-12 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 4.70E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 1.54E-07 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 3.32E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 2.19E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 7.46E-06 | mr1830_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 5.25E-07 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 6.33E-12 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 8.49E-08 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 4.15E-10 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314815996 | NA | 3.51E-09 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |