Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310442654:

Variant ID: vg0310442654 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 10442654
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCGACCAGAACTAACAGAAATATTTGACAGATGGCGAAAGGACCTGTAACCTAATGGTTATAAGAGCCTGCTACTGAGGTCCTGGGTACGACTCTCCA[T/A]
GGGAGCGAATTTTTCAGGATTTAACAACATTGTGATTTCAGTGGTAGGCTACTGTGTAATTTAAAAAAAAAAGAAACGTTTGACAGATGGAGATAAACCT

Reverse complement sequence

AGGTTTATCTCCATCTGTCAAACGTTTCTTTTTTTTTTAAATTACACAGTAGCCTACCACTGAAATCACAATGTTGTTAAATCCTGAAAAATTCGCTCCC[A/T]
TGGAGAGTCGTACCCAGGACCTCAGTAGCAGGCTCTTATAACCATTAGGTTACAGGTCCTTTCGCCATCTGTCAAATATTTCTGTTAGTTCTGGTCGAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	36.50%	0.11%	0.00%	NA
All Indica	2759	98.40%	1.50%	0.07%	0.00%	NA
All Japonica	1512	1.10%	98.90%	0.00%	0.00%	NA
Aus	269	72.90%	26.40%	0.74%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	97.80%	2.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.00%	0.13%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	27.10%	71.90%	1.04%	0.00%	NA
Intermediate	90	46.70%	53.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0310442654	T -> A	LOC_Os03g18640.1	upstream_gene_variant ; 598.0bp to feature; MODIFIER	silent_mutation	Average:48.559; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0310442654	T -> A	LOC_Os03g18630.1	downstream_gene_variant ; 2152.0bp to feature; MODIFIER	silent_mutation	Average:48.559; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0310442654	T -> A	LOC_Os03g18630-LOC_Os03g18640	intergenic_region ; MODIFIER	silent_mutation	Average:48.559; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0310442654	NA	1.23E-18	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0310442654	NA	1.73E-27	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	1.64E-57	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	2.25E-50	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	1.69E-41	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	1.17E-50	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	6.01E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	1.88E-78	mr1087_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	1.85E-62	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	2.08E-58	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	2.77E-77	mr1246_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	6.50E-50	mr1404_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	6.70E-61	mr1526_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	8.28E-32	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	5.91E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	3.21E-79	mr1671_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	3.09E-23	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	1.35E-12	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310442654	NA	5.09E-17	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251