Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0309400270:

Variant ID: vg0309400270 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 9400270
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATACATACGAGTTTCCTATGCACACTTCATACACATCAACTAGCAAATCACGAAAAAATCTAAAAAAAAATAGACATTTACTCCTAATAGTATTACAC[G/A]
TATCTGCAAAATCTCATATTTAAATTTATTATATTTTAACCGTAATAAAAAACGAAAAAATTGACAGTTTAAAGTGTAAAATTCTGTCAGAATTTTGTTT

Reverse complement sequence

AAACAAAATTCTGACAGAATTTTACACTTTAAACTGTCAATTTTTTCGTTTTTTATTACGGTTAAAATATAATAAATTTAAATATGAGATTTTGCAGATA[C/T]
GTGTAATACTATTAGGAGTAAATGTCTATTTTTTTTTAGATTTTTTCGTGATTTGCTAGTTGATGTGTATGAAGTGTGCATAGGAAACTCGTATGTATAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.50%	10.90%	2.60%	0.00%	NA
All Indica	2759	99.10%	0.40%	0.43%	0.00%	NA
All Japonica	1512	60.60%	32.40%	7.01%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.20%	0.20%	0.67%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.70%	0.10%	0.22%	0.00%	NA
Indica Intermediate	786	98.70%	0.50%	0.76%	0.00%	NA
Temperate Japonica	767	34.70%	53.50%	11.86%	0.00%	NA
Tropical Japonica	504	95.20%	3.80%	0.99%	0.00%	NA
Japonica Intermediate	241	70.50%	25.30%	4.15%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	13.30%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0309400270	G -> A	LOC_Os03g16900.1	upstream_gene_variant ; 4523.0bp to feature; MODIFIER	silent_mutation	Average:57.121; most accessible tissue: Callus, score: 79.709	N	N	N	N
vg0309400270	G -> A	LOC_Os03g16910.1	upstream_gene_variant ; 2353.0bp to feature; MODIFIER	silent_mutation	Average:57.121; most accessible tissue: Callus, score: 79.709	N	N	N	N
vg0309400270	G -> A	LOC_Os03g16910.2	upstream_gene_variant ; 2353.0bp to feature; MODIFIER	silent_mutation	Average:57.121; most accessible tissue: Callus, score: 79.709	N	N	N	N
vg0309400270	G -> A	LOC_Os03g16900-LOC_Os03g16910	intergenic_region ; MODIFIER	silent_mutation	Average:57.121; most accessible tissue: Callus, score: 79.709	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0309400270	NA	9.22E-16	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0309400270	NA	6.14E-15	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0309400270	NA	2.63E-16	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0309400270	NA	1.93E-15	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0309400270	NA	5.35E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0309400270	NA	1.58E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	9.90E-11	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	5.79E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	6.22E-12	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	8.30E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	3.64E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	5.35E-06	5.35E-06	mr1186_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	4.24E-06	6.10E-08	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	4.81E-09	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	3.57E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	3.19E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	1.56E-08	mr1454_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	8.22E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	9.50E-11	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	5.66E-07	mr1576_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	4.30E-06	4.29E-06	mr1616_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	6.92E-07	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	5.56E-08	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	7.36E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	1.39E-09	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	9.27E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	3.86E-11	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309400270	NA	7.18E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251