\
| Variant ID: vg0308054850 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 8054850 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 119. )
TTATTTTCTAGAAGTCCCGTCAACCGTTGGAGGCTCTGCAACTATACTCTTATACACCCCGCCCGCTGCTTCTCCTTTTTATTATTGTCATTGAGATTTT[A/T]
AAAATCGAAAATGATTATCAATATGTTTTTTCTTTTTTACTTTCTAGAAGTCCCGGCAACCGCTTTACTTGTTTGCTTCACGGCCTGCCTGACGTCCCTC
GAGGGACGTCAGGCAGGCCGTGAAGCAAACAAGTAAAGCGGTTGCCGGGACTTCTAGAAAGTAAAAAAGAAAAAACATATTGATAATCATTTTCGATTTT[T/A]
AAAATCTCAATGACAATAATAAAAAGGAGAAGCAGCGGGCGGGGTGTATAAGAGTATAGTTGCAGAGCCTCCAACGGTTGACGGGACTTCTAGAAAATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.40% | 41.30% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 31.70% | 67.90% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 96.60% | 3.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 23.40% | 76.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 9.20% | 90.30% | 0.43% | 0.00% | NA |
| Indica III | 913 | 41.00% | 58.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 40.60% | 59.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 91.70% | 8.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 31.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0308054850 | A -> T | LOC_Os03g14800.1 | upstream_gene_variant ; 2303.0bp to feature; MODIFIER | silent_mutation | Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0308054850 | A -> T | LOC_Os03g14800.3 | upstream_gene_variant ; 2303.0bp to feature; MODIFIER | silent_mutation | Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0308054850 | A -> T | LOC_Os03g14800.4 | upstream_gene_variant ; 2283.0bp to feature; MODIFIER | silent_mutation | Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0308054850 | A -> T | LOC_Os03g14800.5 | upstream_gene_variant ; 2283.0bp to feature; MODIFIER | silent_mutation | Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0308054850 | A -> T | LOC_Os03g14800.6 | upstream_gene_variant ; 2283.0bp to feature; MODIFIER | silent_mutation | Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0308054850 | A -> T | LOC_Os03g14800-LOC_Os03g14810 | intergenic_region ; MODIFIER | silent_mutation | Average:28.183; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0308054850 | 9.78E-06 | NA | Grain_length | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0308054850 | 2.95E-06 | NA | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0308054850 | NA | 1.12E-08 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |