\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307765595:

Variant ID: vg0307765595 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7765595
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAAGATGGACATCTTTAGTCCCGGATCCTTACTCCTGGTTGGAAAACCGGGATTAAAGGGGGTTCCCAACCGGGAGTAAAGATGGTTTCTCCACCGGT[A/G]
ACTCCTTGTATAAATTGGCTAGCTTAACATGGTCTTAATTGCATTTTGCCTTTAACTATTATTCATGCATACGAAGGTATATTCAAATCAACCACTTTTA

Reverse complement sequence

TAAAAGTGGTTGATTTGAATATACCTTCGTATGCATGAATAATAGTTAAAGGCAAAATGCAATTAAGACCATGTTAAGCTAGCCAATTTATACAAGGAGT[T/C]
ACCGGTGGAGAAACCATCTTTACTCCCGGTTGGGAACCCCCTTTAATCCCGGTTTTCCAACCAGGAGTAAGGATCCGGGACTAAAGATGTCCATCTTTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 9.30% 0.74% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 69.20% 28.40% 2.31% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 44.10% 52.30% 3.65% 0.00% NA
Tropical Japonica  504 98.40% 1.20% 0.40% 0.00% NA
Japonica Intermediate  241 88.40% 9.50% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307765595 A -> G LOC_Os03g14260.1 upstream_gene_variant ; 1867.0bp to feature; MODIFIER silent_mutation Average:53.212; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0307765595 A -> G LOC_Os03g14260.2 upstream_gene_variant ; 1867.0bp to feature; MODIFIER silent_mutation Average:53.212; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0307765595 A -> G LOC_Os03g14270.1 downstream_gene_variant ; 1467.0bp to feature; MODIFIER silent_mutation Average:53.212; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0307765595 A -> G LOC_Os03g14260-LOC_Os03g14270 intergenic_region ; MODIFIER silent_mutation Average:53.212; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307765595 NA 9.51E-14 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0307765595 NA 9.79E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0307765595 NA 1.64E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0307765595 NA 4.42E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0307765595 NA 4.70E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 9.30E-06 9.30E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 3.16E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 3.61E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 6.97E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 7.96E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 2.76E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 1.27E-06 7.81E-09 mr1321_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 9.88E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 4.10E-06 NA mr1439_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 3.48E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 3.45E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 7.74E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 6.95E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 3.08E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 6.04E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 9.54E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307765595 NA 3.02E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251