Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307718560:

Variant ID: vg0307718560 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7718560
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AACGACAGGACGATGTTCAGTAGAAAGAGGCGGTCGCAGCTAAGGGCAAGTACTACGAGCCTCTACACATTGCCCCTAAATTTGTCACATAAGATTAGAT[G/A]
ATGAGGTGGAGGAGAGAAGTTAGGAGAGAGAGAATGAGCCACCCCTCATGCAAGAGGCAACCTCTACACAATCTTCAAGAAAAGTGCAAGATGATGTGAG

Reverse complement sequence

CTCACATCATCTTGCACTTTTCTTGAAGATTGTGTAGAGGTTGCCTCTTGCATGAGGGGTGGCTCATTCTCTCTCTCCTAACTTCTCTCCTCCACCTCAT[C/T]
ATCTAATCTTATGTGACAAATTTAGGGGCAATGTGTAGAGGCTCGTAGTACTTGCCCTTAGCTGCGACCGCCTCTTTCTACTGAACATCGTCCTGTCGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 18.80% 0.02% 0.38% NA
All Indica  2759 90.00% 9.50% 0.04% 0.51% NA
All Japonica  1512 81.90% 17.90% 0.00% 0.13% NA
Aus  269 3.00% 96.70% 0.00% 0.37% NA
Indica I  595 85.70% 13.80% 0.00% 0.50% NA
Indica II  465 96.60% 3.20% 0.00% 0.22% NA
Indica III  913 89.70% 9.70% 0.00% 0.55% NA
Indica Intermediate  786 89.70% 9.50% 0.13% 0.64% NA
Temperate Japonica  767 81.70% 18.30% 0.00% 0.00% NA
Tropical Japonica  504 77.80% 22.00% 0.00% 0.20% NA
Japonica Intermediate  241 91.30% 8.30% 0.00% 0.41% NA
VI/Aromatic  96 16.70% 82.30% 0.00% 1.04% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307718560 G -> A LOC_Os03g14220.1 downstream_gene_variant ; 2746.0bp to feature; MODIFIER silent_mutation Average:81.752; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0307718560 G -> A LOC_Os03g14230.1 downstream_gene_variant ; 2070.0bp to feature; MODIFIER silent_mutation Average:81.752; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0307718560 G -> A LOC_Os03g14220-LOC_Os03g14230 intergenic_region ; MODIFIER silent_mutation Average:81.752; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0307718560 G -> DEL N N silent_mutation Average:81.752; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0307718560 G A 0.03 -0.01 -0.01 0.03 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307718560 3.89E-06 NA Yield All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0307718560 NA 9.74E-13 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307718560 NA 1.21E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307718560 NA 1.91E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251