\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307641865:

Variant ID: vg0307641865 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7641865
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAAGCGCTTTGTGCGATTGCTCCCTGTTTGTCCGCAACGGCTCGTCTTCCTCTTCGCTCGCGTGCTGCGTGCCTTCGTAGACTCCTGCGAAAAGTTTCG[G/A]
CCGAGCAGCCGGTCTTTCCACCACCTTGGTACGTGTTCAATATGTTGCGCATATTTGATCTGTTCATGTTATACTGTGTAGTTTACATGTGTAGATCTAA

Reverse complement sequence

TTAGATCTACACATGTAAACTACACAGTATAACATGAACAGATCAAATATGCGCAACATATTGAACACGTACCAAGGTGGTGGAAAGACCGGCTGCTCGG[C/T]
CGAAACTTTTCGCAGGAGTCTACGAAGGCACGCAGCACGCGAGCGAAGAGGAAGACGAGCCGTTGCGGACAAACAGGGAGCAATCGCACAAAGCGCTTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 27.80% 3.30% 0.40% NA
All Indica  2759 94.50% 0.60% 4.28% 0.65% NA
All Japonica  1512 14.70% 83.50% 1.65% 0.07% NA
Aus  269 98.10% 0.40% 1.49% 0.00% NA
Indica I  595 88.10% 0.50% 11.26% 0.17% NA
Indica II  465 92.90% 0.20% 4.95% 1.94% NA
Indica III  913 99.00% 0.50% 0.22% 0.22% NA
Indica Intermediate  786 95.00% 0.90% 3.31% 0.76% NA
Temperate Japonica  767 18.50% 80.40% 0.91% 0.13% NA
Tropical Japonica  504 13.90% 82.70% 3.37% 0.00% NA
Japonica Intermediate  241 4.60% 95.00% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 2.10% 4.17% 0.00% NA
Intermediate  90 60.00% 34.40% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307641865 G -> A LOC_Os03g14070.1 upstream_gene_variant ; 4014.0bp to feature; MODIFIER silent_mutation Average:24.283; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0307641865 G -> A LOC_Os03g14080.1 upstream_gene_variant ; 4781.0bp to feature; MODIFIER silent_mutation Average:24.283; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0307641865 G -> A LOC_Os03g14060.1 downstream_gene_variant ; 119.0bp to feature; MODIFIER silent_mutation Average:24.283; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0307641865 G -> A LOC_Os03g14060-LOC_Os03g14070 intergenic_region ; MODIFIER silent_mutation Average:24.283; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0307641865 G -> DEL N N silent_mutation Average:24.283; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307641865 NA 2.88E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0307641865 NA 1.04E-17 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 3.54E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 1.96E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 1.11E-06 NA mr1525 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 2.87E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 2.83E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 2.92E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 1.48E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 1.21E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 3.05E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 1.58E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 9.20E-19 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 8.27E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 1.93E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 6.27E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 9.80E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 5.87E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 7.59E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 6.66E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307641865 NA 1.39E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251