Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0306466083:

Variant ID: vg0306466083 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6466083
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACGAACTATGGCGGTCGTCCAAATTACCCCTCTGAACCATAAAACCGGACATTCTTCACCCCCCAACTATGCAAACCGGACGAATTACCCCCCTCGAC[C/T]
CAATCCACGATGGTTTTGGTCTACATGGCATACGCGTGGCAGTCCAGTCAGCATTTTATTTATTAAAAAAATGTAGGACCCACCTGTCATACTCATATTC

Reverse complement sequence

GAATATGAGTATGACAGGTGGGTCCTACATTTTTTTAATAAATAAAATGCTGACTGGACTGCCACGCGTATGCCATGTAGACCAAAACCATCGTGGATTG[G/A]
GTCGAGGGGGGTAATTCGTCCGGTTTGCATAGTTGGGGGGTGAAGAATGTCCGGTTTTATGGTTCAGAGGGGTAATTTGGACGACCGCCATAGTTCGTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 8.70% 1.25% 2.16% NA
All Indica  2759 95.70% 0.00% 0.65% 3.62% NA
All Japonica  1512 70.60% 26.80% 2.65% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 92.90% 0.00% 1.72% 5.38% NA
Indica III  913 95.70% 0.00% 0.55% 3.72% NA
Indica Intermediate  786 94.10% 0.00% 0.64% 5.22% NA
Temperate Japonica  767 50.70% 44.30% 4.95% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 75.10% 24.10% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306466083 C -> T LOC_Os03g12290.1 upstream_gene_variant ; 3356.0bp to feature; MODIFIER silent_mutation Average:82.639; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0306466083 C -> T LOC_Os03g12300.1 downstream_gene_variant ; 2229.0bp to feature; MODIFIER silent_mutation Average:82.639; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0306466083 C -> T LOC_Os03g12300.2 downstream_gene_variant ; 2229.0bp to feature; MODIFIER silent_mutation Average:82.639; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0306466083 C -> T LOC_Os03g12290-LOC_Os03g12300 intergenic_region ; MODIFIER silent_mutation Average:82.639; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0306466083 C -> DEL N N silent_mutation Average:82.639; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0306466083 C T -0.02 -0.02 -0.01 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306466083 NA 2.93E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306466083 NA 9.88E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 3.45E-07 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 NA 4.18E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 NA 5.46E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 NA 8.45E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 8.80E-06 8.80E-06 mr1254 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 NA 3.04E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 2.61E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 NA 5.79E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 1.29E-06 NA mr1671 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 NA 2.14E-08 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 NA 1.29E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 4.31E-06 NA mr1882 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 NA 4.56E-07 mr1882 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 3.64E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 NA 1.09E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306466083 NA 5.03E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251