Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306207246:

Variant ID: vg0306207246 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 6207246
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCGCTATGTTCTTGTTCCTGTTCTACATGATGCCTTTAGCATGTTATCGCATTATTGGTATGTTCCTGATTCTGACATTCATGATGCGCTTAGTATGCT[A/G]
CTGGTTATGTTAAGATCACCCTACACTGCTTATGCCATGATCATAGTTTCAATTTCTTGGATTAAAATATGCCGAATAATGACTATATTTCCAACAATCC

Reverse complement sequence

GGATTGTTGGAAATATAGTCATTATTCGGCATATTTTAATCCAAGAAATTGAAACTATGATCATGGCATAAGCAGTGTAGGGTGATCTTAACATAACCAG[T/C]
AGCATACTAAGCGCATCATGAATGTCAGAATCAGGAACATACCAATAATGCGATAACATGCTAAAGGCATCATGTAGAACAGGAACAAGAACATAGCGCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.90%	8.70%	5.29%	61.11%	NA
All Indica	2759	1.70%	0.00%	8.26%	90.03%	NA
All Japonica	1512	71.90%	26.50%	0.66%	0.93%	NA
Aus	269	1.50%	0.00%	1.49%	97.03%	NA
Indica I	595	1.30%	0.00%	13.45%	85.21%	NA
Indica II	465	1.70%	0.20%	7.96%	90.11%	NA
Indica III	913	1.30%	0.00%	3.72%	94.96%	NA
Indica Intermediate	786	2.30%	0.00%	9.80%	87.91%	NA
Temperate Japonica	767	54.40%	43.20%	1.04%	1.43%	NA
Tropical Japonica	504	98.00%	1.40%	0.20%	0.40%	NA
Japonica Intermediate	241	73.00%	26.10%	0.41%	0.41%	NA
VI/Aromatic	96	9.40%	0.00%	0.00%	90.62%	NA
Intermediate	90	35.60%	8.90%	8.89%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0306207246	A -> DEL	LOC_Os03g11850.1	N	frameshift_variant	Average:7.327; most accessible tissue: Callus, score: 32.958	N	N	N	N
vg0306207246	A -> G	LOC_Os03g11850.1	synonymous_variant ; p.Leu120Leu; LOW	synonymous_codon	Average:7.327; most accessible tissue: Callus, score: 32.958	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0306207246	NA	8.30E-18	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306207246	NA	2.57E-16	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306207246	NA	3.48E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306207246	NA	5.75E-17	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306207246	NA	1.39E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306207246	5.90E-07	NA	mr1092	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	6.17E-08	mr1092	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	6.13E-06	NA	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	1.37E-07	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	7.87E-07	mr1154	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	4.56E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	3.19E-06	mr1896	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	7.56E-06	7.55E-06	mr1935	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	2.72E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	1.08E-09	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	2.09E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	3.37E-06	mr1152_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	6.25E-06	mr1154_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	2.51E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	1.71E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	1.03E-06	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246	NA	4.12E-11	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251