\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0306207246:

Variant ID: vg0306207246 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 6207246
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCGCTATGTTCTTGTTCCTGTTCTACATGATGCCTTTAGCATGTTATCGCATTATTGGTATGTTCCTGATTCTGACATTCATGATGCGCTTAGTATGCT[A/G]
CTGGTTATGTTAAGATCACCCTACACTGCTTATGCCATGATCATAGTTTCAATTTCTTGGATTAAAATATGCCGAATAATGACTATATTTCCAACAATCC

Reverse complement sequence

GGATTGTTGGAAATATAGTCATTATTCGGCATATTTTAATCCAAGAAATTGAAACTATGATCATGGCATAAGCAGTGTAGGGTGATCTTAACATAACCAG[T/C]
AGCATACTAAGCGCATCATGAATGTCAGAATCAGGAACATACCAATAATGCGATAACATGCTAAAGGCATCATGTAGAACAGGAACAAGAACATAGCGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.90% 8.70% 5.29% 61.11% NA
All Indica  2759 1.70% 0.00% 8.26% 90.03% NA
All Japonica  1512 71.90% 26.50% 0.66% 0.93% NA
Aus  269 1.50% 0.00% 1.49% 97.03% NA
Indica I  595 1.30% 0.00% 13.45% 85.21% NA
Indica II  465 1.70% 0.20% 7.96% 90.11% NA
Indica III  913 1.30% 0.00% 3.72% 94.96% NA
Indica Intermediate  786 2.30% 0.00% 9.80% 87.91% NA
Temperate Japonica  767 54.40% 43.20% 1.04% 1.43% NA
Tropical Japonica  504 98.00% 1.40% 0.20% 0.40% NA
Japonica Intermediate  241 73.00% 26.10% 0.41% 0.41% NA
VI/Aromatic  96 9.40% 0.00% 0.00% 90.62% NA
Intermediate  90 35.60% 8.90% 8.89% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0306207246 A -> DEL LOC_Os03g11850.1 N frameshift_variant Average:7.327; most accessible tissue: Callus, score: 32.958 N N N N
vg0306207246 A -> G LOC_Os03g11850.1 synonymous_variant ; p.Leu120Leu; LOW synonymous_codon Average:7.327; most accessible tissue: Callus, score: 32.958 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0306207246 NA 8.30E-18 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306207246 NA 2.57E-16 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306207246 NA 3.48E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306207246 NA 5.75E-17 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306207246 NA 1.39E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0306207246 5.90E-07 NA mr1092 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 6.17E-08 mr1092 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 6.13E-06 NA mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 1.37E-07 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 7.87E-07 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 4.56E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 3.19E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 7.56E-06 7.55E-06 mr1935 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 2.72E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 1.08E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 2.09E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 3.37E-06 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 6.25E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 2.51E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 1.71E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 1.03E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0306207246 NA 4.12E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251