\
| Variant ID: vg0305009028 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 5009028 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )
AGAACACGAAGAACAGAGGAAGAACAGGAAGAGAGAGATGGAATTAGAGTTTGAATTGTTGATATTACATTGTTCGATCCAATCTCGGTCTTCCTGTCGG[C/T]
TTTTATAGCAAGACACCATTAAGCCTCTCTCATCTCTCTATTAGTGGCCCAGTCTACAGCTACTGGGTCCACTCACTCACAGGGAAGCGAGAATTCGGCC
GGCCGAATTCTCGCTTCCCTGTGAGTGAGTGGACCCAGTAGCTGTAGACTGGGCCACTAATAGAGAGATGAGAGAGGCTTAATGGTGTCTTGCTATAAAA[G/A]
CCGACAGGAAGACCGAGATTGGATCGAACAATGTAATATCAACAATTCAAACTCTAATTCCATCTCTCTCTTCCTGTTCTTCCTCTGTTCTTCGTGTTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 21.20% | 3.75% | 0.57% | NA |
| All Indica | 2759 | 57.40% | 35.60% | 6.38% | 0.54% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.07% | NA |
| Aus | 269 | 97.80% | 0.00% | 0.00% | 2.23% | NA |
| Indica I | 595 | 27.10% | 57.00% | 15.97% | 0.00% | NA |
| Indica II | 465 | 38.30% | 54.60% | 7.10% | 0.00% | NA |
| Indica III | 913 | 82.90% | 14.70% | 0.77% | 1.64% | NA |
| Indica Intermediate | 786 | 62.20% | 32.60% | 5.22% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 83.30% | 14.40% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0305009028 | C -> T | LOC_Os03g09990.1 | upstream_gene_variant ; 4062.0bp to feature; MODIFIER | silent_mutation | Average:34.893; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0305009028 | C -> T | LOC_Os03g10000.1 | upstream_gene_variant ; 224.0bp to feature; MODIFIER | silent_mutation | Average:34.893; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0305009028 | C -> T | LOC_Os03g10000-LOC_Os03g10010 | intergenic_region ; MODIFIER | silent_mutation | Average:34.893; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0305009028 | C -> DEL | N | N | silent_mutation | Average:34.893; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0305009028 | NA | 9.15E-12 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0305009028 | NA | 3.09E-19 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0305009028 | NA | 1.53E-08 | Yield | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0305009028 | NA | 1.31E-11 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 1.06E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 7.49E-17 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 6.03E-17 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 1.95E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 4.06E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | 1.07E-07 | NA | mr1103_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 3.59E-08 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | 3.45E-06 | 2.72E-07 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | 1.44E-07 | NA | mr1246_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | 1.47E-08 | 6.39E-08 | mr1246_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 6.00E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 3.10E-06 | mr1404_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 5.81E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 3.03E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 4.27E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 3.02E-13 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 1.03E-13 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 6.14E-08 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 5.02E-20 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305009028 | NA | 3.52E-07 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |