| Variant ID: vg0303440042 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 3440042 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATCATTTAATAATAATAAAAATACTAATCATAAAAATTTTCAAATAAGACAGTGTCAAAACATTATATACTACATCTGTCCCAAAATAAGTGCAACCAT[A/G]
GATATTCGTGCCCAACGTTTGACCGCCCGTCTTATTTGAAATTTTTGTGAAAAAATTAAAAATATTTAGTCACACATAAAGTACTATTCATATTTTATCA
TGATAAAATATGAATAGTACTTTATGTGTGACTAAATATTTTTAATTTTTTCACAAAAATTTCAAATAAGACGGGCGGTCAAACGTTGGGCACGAATATC[T/C]
ATGGTTGCACTTATTTTGGGACAGATGTAGTATATAATGTTTTGACACTGTCTTATTTGAAAATTTTTATGATTAGTATTTTTATTATTATTAAATGATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 38.20% | 0.04% | 0.74% | NA |
| All Indica | 2759 | 93.50% | 5.30% | 0.04% | 1.23% | NA |
| All Japonica | 1512 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 77.70% | 21.90% | 0.00% | 0.37% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 90.10% | 6.20% | 0.00% | 3.66% | NA |
| Indica III | 913 | 90.70% | 8.70% | 0.11% | 0.55% | NA |
| Indica Intermediate | 786 | 93.90% | 4.70% | 0.00% | 1.40% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 50.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0303440042 | A -> DEL | N | N | silent_mutation | Average:33.53; most accessible tissue: Callus, score: 58.367 | N | N | N | N |
| vg0303440042 | A -> G | LOC_Os03g06750.1 | upstream_gene_variant ; 4608.0bp to feature; MODIFIER | silent_mutation | Average:33.53; most accessible tissue: Callus, score: 58.367 | N | N | N | N |
| vg0303440042 | A -> G | LOC_Os03g06760.1 | downstream_gene_variant ; 498.0bp to feature; MODIFIER | silent_mutation | Average:33.53; most accessible tissue: Callus, score: 58.367 | N | N | N | N |
| vg0303440042 | A -> G | LOC_Os03g06760.2 | downstream_gene_variant ; 498.0bp to feature; MODIFIER | silent_mutation | Average:33.53; most accessible tissue: Callus, score: 58.367 | N | N | N | N |
| vg0303440042 | A -> G | LOC_Os03g06760-LOC_Os03g06780 | intergenic_region ; MODIFIER | silent_mutation | Average:33.53; most accessible tissue: Callus, score: 58.367 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0303440042 | NA | 1.44E-19 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0303440042 | NA | 6.53E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303440042 | NA | 9.55E-30 | mr1298 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303440042 | NA | 9.35E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303440042 | NA | 7.49E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303440042 | NA | 4.59E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303440042 | NA | 1.02E-06 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303440042 | NA | 7.98E-29 | mr1731 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303440042 | NA | 4.73E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303440042 | NA | 1.85E-21 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303440042 | NA | 9.06E-21 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303440042 | NA | 9.77E-22 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |