Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229928131:

Variant ID: vg0229928131 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 29928131
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGTCATTTATGTCCAGCCATGACGCGGAGAGGGCTCGGTCCGCCACCCACGGTCGCGACATCTACGATGGGGGCTGCTTACTGGATGTGCAGCACGTC[T/C]
AGATGTTCCCTGGAGATGGCGCCACCGCCACGCACACCACCTGTTTGACAATGGTACCAAGTAGCGCCACCGCCAGGCCAGCGGCCAAGAGTATTGCTGC

Reverse complement sequence

GCAGCAATACTCTTGGCCGCTGGCCTGGCGGTGGCGCTACTTGGTACCATTGTCAAACAGGTGGTGTGCGTGGCGGTGGCGCCATCTCCAGGGAACATCT[A/G]
GACGTGCTGCACATCCAGTAAGCAGCCCCCATCGTAGATGTCGCGACCGTGGGTGGCGGACCGAGCCCTCTCCGCGTCATGGCTGGACATAAATGACACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.50%	13.20%	2.33%	0.00%	NA
All Indica	2759	99.10%	0.80%	0.11%	0.00%	NA
All Japonica	1512	54.30%	38.90%	6.81%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	1.70%	0.38%	0.00%	NA
Temperate Japonica	767	26.10%	64.70%	9.26%	0.00%	NA
Tropical Japonica	504	92.70%	5.00%	2.38%	0.00%	NA
Japonica Intermediate	241	63.90%	27.80%	8.30%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	13.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0229928131	T -> C	LOC_Os02g48920.1	upstream_gene_variant ; 4954.0bp to feature; MODIFIER	silent_mutation	Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0229928131	T -> C	LOC_Os02g48930.1	upstream_gene_variant ; 1207.0bp to feature; MODIFIER	silent_mutation	Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0229928131	T -> C	LOC_Os02g48950.1	downstream_gene_variant ; 3496.0bp to feature; MODIFIER	silent_mutation	Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0229928131	T -> C	LOC_Os02g48940.1	intron_variant ; MODIFIER	silent_mutation	Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0229928131	NA	2.47E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229928131	NA	1.05E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229928131	NA	3.77E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229928131	NA	4.90E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229928131	8.60E-06	8.59E-06	mr1011	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	2.31E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	1.32E-12	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	3.13E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	3.56E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	9.85E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	3.69E-06	3.52E-23	mr1163	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	2.27E-10	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	5.00E-08	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	1.27E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	1.38E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	8.98E-07	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	1.33E-07	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	8.19E-10	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	1.64E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	1.39E-09	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	1.80E-07	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131	NA	2.89E-06	mr1977_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251