\
| Variant ID: vg0229928131 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 29928131 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )
TGTGTCATTTATGTCCAGCCATGACGCGGAGAGGGCTCGGTCCGCCACCCACGGTCGCGACATCTACGATGGGGGCTGCTTACTGGATGTGCAGCACGTC[T/C]
AGATGTTCCCTGGAGATGGCGCCACCGCCACGCACACCACCTGTTTGACAATGGTACCAAGTAGCGCCACCGCCAGGCCAGCGGCCAAGAGTATTGCTGC
GCAGCAATACTCTTGGCCGCTGGCCTGGCGGTGGCGCTACTTGGTACCATTGTCAAACAGGTGGTGTGCGTGGCGGTGGCGCCATCTCCAGGGAACATCT[A/G]
GACGTGCTGCACATCCAGTAAGCAGCCCCCATCGTAGATGTCGCGACCGTGGGTGGCGGACCGAGCCCTCTCCGCGTCATGGCTGGACATAAATGACACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.50% | 13.20% | 2.33% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.80% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 54.30% | 38.90% | 6.81% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 1.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 26.10% | 64.70% | 9.26% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 5.00% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.90% | 27.80% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 13.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0229928131 | T -> C | LOC_Os02g48920.1 | upstream_gene_variant ; 4954.0bp to feature; MODIFIER | silent_mutation | Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0229928131 | T -> C | LOC_Os02g48930.1 | upstream_gene_variant ; 1207.0bp to feature; MODIFIER | silent_mutation | Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0229928131 | T -> C | LOC_Os02g48950.1 | downstream_gene_variant ; 3496.0bp to feature; MODIFIER | silent_mutation | Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0229928131 | T -> C | LOC_Os02g48940.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0229928131 | NA | 2.47E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0229928131 | NA | 1.05E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0229928131 | NA | 3.77E-13 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0229928131 | NA | 4.90E-11 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0229928131 | 8.60E-06 | 8.59E-06 | mr1011 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 2.31E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 1.32E-12 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 3.13E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 3.56E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 9.85E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | 3.69E-06 | 3.52E-23 | mr1163 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 2.27E-10 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 5.00E-08 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 1.27E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 1.38E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 8.98E-07 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 1.33E-07 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 8.19E-10 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 1.64E-06 | mr1851_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 1.39E-09 | mr1864_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 1.80E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229928131 | NA | 2.89E-06 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |