\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229928131:

Variant ID: vg0229928131 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29928131
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGTCATTTATGTCCAGCCATGACGCGGAGAGGGCTCGGTCCGCCACCCACGGTCGCGACATCTACGATGGGGGCTGCTTACTGGATGTGCAGCACGTC[T/C]
AGATGTTCCCTGGAGATGGCGCCACCGCCACGCACACCACCTGTTTGACAATGGTACCAAGTAGCGCCACCGCCAGGCCAGCGGCCAAGAGTATTGCTGC

Reverse complement sequence

GCAGCAATACTCTTGGCCGCTGGCCTGGCGGTGGCGCTACTTGGTACCATTGTCAAACAGGTGGTGTGCGTGGCGGTGGCGCCATCTCCAGGGAACATCT[A/G]
GACGTGCTGCACATCCAGTAAGCAGCCCCCATCGTAGATGTCGCGACCGTGGGTGGCGGACCGAGCCCTCTCCGCGTCATGGCTGGACATAAATGACACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 13.20% 2.33% 0.00% NA
All Indica  2759 99.10% 0.80% 0.11% 0.00% NA
All Japonica  1512 54.30% 38.90% 6.81% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 1.70% 0.38% 0.00% NA
Temperate Japonica  767 26.10% 64.70% 9.26% 0.00% NA
Tropical Japonica  504 92.70% 5.00% 2.38% 0.00% NA
Japonica Intermediate  241 63.90% 27.80% 8.30% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 13.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229928131 T -> C LOC_Os02g48920.1 upstream_gene_variant ; 4954.0bp to feature; MODIFIER silent_mutation Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0229928131 T -> C LOC_Os02g48930.1 upstream_gene_variant ; 1207.0bp to feature; MODIFIER silent_mutation Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0229928131 T -> C LOC_Os02g48950.1 downstream_gene_variant ; 3496.0bp to feature; MODIFIER silent_mutation Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0229928131 T -> C LOC_Os02g48940.1 intron_variant ; MODIFIER silent_mutation Average:49.406; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229928131 NA 2.47E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229928131 NA 1.05E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229928131 NA 3.77E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229928131 NA 4.90E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229928131 8.60E-06 8.59E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 2.31E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 1.32E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 3.13E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 3.56E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 9.85E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 3.69E-06 3.52E-23 mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 2.27E-10 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 5.00E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 1.27E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 1.38E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 8.98E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 1.33E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 8.19E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 1.64E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 1.39E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 1.80E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229928131 NA 2.89E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251