Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221095942:

Variant ID: vg0221095942 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21095942
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGCTTAGTTCCTAATAGCGGTTGTACCACTGAAAAATGTTTCTAGCTGTTACAACGCACGAGCATTTTTTCTAGTCATAAAAATATTTTAAATAAGATG[G/A]
ATGGTCAAAATTGGATACTGAAACCTATAACAGCGCTTATTATAGGACGGCGAGAGTATATGCAAAGACGTGCTCTACCTACCAAAAAGAAGCAGCTCGC

Reverse complement sequence

GCGAGCTGCTTCTTTTTGGTAGGTAGAGCACGTCTTTGCATATACTCTCGCCGTCCTATAATAAGCGCTGTTATAGGTTTCAGTATCCAATTTTGACCAT[C/T]
CATCTTATTTAAAATATTTTTATGACTAGAAAAAATGCTCGTGCGTTGTAACAGCTAGAAACATTTTTCAGTGGTACAACCGCTATTAGGAACTAAGCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 38.90% 0.00% 0.00% NA
All Indica  2759 92.30% 7.70% 0.00% 0.00% NA
All Japonica  1512 2.00% 98.00% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 84.80% 15.20% 0.00% 0.00% NA
Indica Intermediate  786 93.80% 6.20% 0.00% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221095942 G -> A LOC_Os02g35140.1 upstream_gene_variant ; 2208.0bp to feature; MODIFIER silent_mutation Average:97.696; most accessible tissue: Zhenshan97 panicle, score: 99.048 N N N N
vg0221095942 G -> A LOC_Os02g35130-LOC_Os02g35140 intergenic_region ; MODIFIER silent_mutation Average:97.696; most accessible tissue: Zhenshan97 panicle, score: 99.048 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221095942 G A 0.0 0.01 0.02 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221095942 NA 1.11E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0221095942 NA 4.03E-71 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 4.87E-82 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 3.58E-75 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 1.57E-20 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 2.36E-24 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 2.56E-88 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 1.19E-87 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 7.98E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 6.34E-35 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 1.23E-85 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 3.31E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 3.55E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 1.49E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 1.74E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 2.71E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 1.67E-98 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 3.23E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 3.55E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 1.42E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 4.04E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 3.32E-06 NA mr1717_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221095942 NA 1.31E-35 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251