Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220874371:

Variant ID: vg0220874371 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20874371
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATCCAGCCATAGCGACGCGGATCTGGCGGTCACCACCGCCACTACCCTAGGCGGCTCCCTTGGCCGCCCGAGCGCGAGAAGCGAGAAGCCCCGCCACC[G/A]
CCGTCCTTGTGGCCGCGCAGCTTTGCCGACGGCCACTCAGGTGGCAGCGAGGCGGAGGAGGAAGGTGGGGGAGAGGGGGCAACCGGGTCGTCGCCTCCCA

Reverse complement sequence

TGGGAGGCGACGACCCGGTTGCCCCCTCTCCCCCACCTTCCTCCTCCGCCTCGCTGCCACCTGAGTGGCCGTCGGCAAAGCTGCGCGGCCACAAGGACGG[C/T]
GGTGGCGGGGCTTCTCGCTTCTCGCGCTCGGGCGGCCAAGGGAGCCGCCTAGGGTAGTGGCGGTGGTGACCGCCAGATCCGCGTCGCTATGGCTGGATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 41.20% 0.02% 0.00% NA
All Indica  2759 94.70% 5.30% 0.04% 0.00% NA
All Japonica  1512 1.60% 98.40% 0.00% 0.00% NA
Aus  269 38.30% 61.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 92.90% 7.00% 0.11% 0.00% NA
Indica Intermediate  786 92.10% 7.90% 0.00% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 36.70% 63.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220874371 G -> A LOC_Os02g34810.1 upstream_gene_variant ; 2292.0bp to feature; MODIFIER silent_mutation Average:81.313; most accessible tissue: Minghui63 flag leaf, score: 90.261 N N N N
vg0220874371 G -> A LOC_Os02g34820.1 upstream_gene_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:81.313; most accessible tissue: Minghui63 flag leaf, score: 90.261 N N N N
vg0220874371 G -> A LOC_Os02g34830.1 upstream_gene_variant ; 3611.0bp to feature; MODIFIER silent_mutation Average:81.313; most accessible tissue: Minghui63 flag leaf, score: 90.261 N N N N
vg0220874371 G -> A LOC_Os02g34820-LOC_Os02g34830 intergenic_region ; MODIFIER silent_mutation Average:81.313; most accessible tissue: Minghui63 flag leaf, score: 90.261 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0220874371 G A -0.01 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220874371 NA 1.14E-18 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0220874371 NA 5.43E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.11E-25 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.20E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.55E-30 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 5.40E-71 mr1246 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 4.23E-09 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.04E-10 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 2.24E-11 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 2.25E-34 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.87E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 3.24E-67 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 7.35E-10 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 7.52E-46 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.29E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.57E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.41E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 2.22E-06 5.98E-16 mr1151_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.27E-39 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 2.79E-51 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 3.36E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 8.61E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 6.01E-81 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.64E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 7.41E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.04E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 2.13E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 9.48E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 3.19E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 3.88E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 1.25E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 8.13E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 7.08E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 3.15E-30 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 8.99E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220874371 NA 4.60E-46 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251