Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0218567229:

Variant ID: vg0218567229 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18567229
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAGGTGTTGCTTGTGCTTTTACTGTTCAAATGTGCTTTTCAAAACTTGCTTGTATATACACCAAAAAATAAGCACTTTTTATGCTCACAGTTTGGATT[T/C]
GGTAAGTTGATGATTTATAGTTGGCTTTGCATGAAGTTAGTAGTCTCCTTGGAGACAAGCCAACAAATATTTAAATCCTACCCAAGCTGGAAACCATATC

Reverse complement sequence

GATATGGTTTCCAGCTTGGGTAGGATTTAAATATTTGTTGGCTTGTCTCCAAGGAGACTACTAACTTCATGCAAAGCCAACTATAAATCATCAACTTACC[A/G]
AATCCAAACTGTGAGCATAAAAAGTGCTTATTTTTTGGTGTATATACAAGCAAGTTTTGAAAAGCACATTTGAACAGTAAAAGCACAAGCAACACCTTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.00%	9.20%	0.78%	0.00%	NA
All Indica	2759	99.70%	0.20%	0.04%	0.00%	NA
All Japonica	1512	69.60%	28.00%	2.38%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	46.30%	49.30%	4.43%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	82.20%	17.00%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218567229	T -> C	LOC_Os02g31074.1	downstream_gene_variant ; 2536.0bp to feature; MODIFIER	silent_mutation	Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg0218567229	T -> C	LOC_Os02g31070.1	intron_variant ; MODIFIER	silent_mutation	Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg0218567229	T -> C	LOC_Os02g31070.2	intron_variant ; MODIFIER	silent_mutation	Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg0218567229	T -> C	LOC_Os02g31070.4	intron_variant ; MODIFIER	silent_mutation	Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg0218567229	T -> C	LOC_Os02g31070.3	intron_variant ; MODIFIER	silent_mutation	Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218567229	NA	5.19E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0218567229	4.86E-06	NA	mr1609	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218567229	6.62E-07	6.62E-07	mr1609	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218567229	NA	1.16E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218567229	NA	1.96E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218567229	NA	2.65E-06	mr1576_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218567229	NA	1.77E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251