| Variant ID: vg0218567229 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18567229 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )
TCAAGGTGTTGCTTGTGCTTTTACTGTTCAAATGTGCTTTTCAAAACTTGCTTGTATATACACCAAAAAATAAGCACTTTTTATGCTCACAGTTTGGATT[T/C]
GGTAAGTTGATGATTTATAGTTGGCTTTGCATGAAGTTAGTAGTCTCCTTGGAGACAAGCCAACAAATATTTAAATCCTACCCAAGCTGGAAACCATATC
GATATGGTTTCCAGCTTGGGTAGGATTTAAATATTTGTTGGCTTGTCTCCAAGGAGACTACTAACTTCATGCAAAGCCAACTATAAATCATCAACTTACC[A/G]
AATCCAAACTGTGAGCATAAAAAGTGCTTATTTTTTGGTGTATATACAAGCAAGTTTTGAAAAGCACATTTGAACAGTAAAAGCACAAGCAACACCTTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.00% | 9.20% | 0.78% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 69.60% | 28.00% | 2.38% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 46.30% | 49.30% | 4.43% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.20% | 17.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218567229 | T -> C | LOC_Os02g31074.1 | downstream_gene_variant ; 2536.0bp to feature; MODIFIER | silent_mutation | Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| vg0218567229 | T -> C | LOC_Os02g31070.1 | intron_variant ; MODIFIER | silent_mutation | Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| vg0218567229 | T -> C | LOC_Os02g31070.2 | intron_variant ; MODIFIER | silent_mutation | Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| vg0218567229 | T -> C | LOC_Os02g31070.4 | intron_variant ; MODIFIER | silent_mutation | Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| vg0218567229 | T -> C | LOC_Os02g31070.3 | intron_variant ; MODIFIER | silent_mutation | Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218567229 | NA | 5.19E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0218567229 | 4.86E-06 | NA | mr1609 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218567229 | 6.62E-07 | 6.62E-07 | mr1609 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218567229 | NA | 1.16E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218567229 | NA | 1.96E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218567229 | NA | 2.65E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218567229 | NA | 1.77E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |