\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218567229:

Variant ID: vg0218567229 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18567229
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAGGTGTTGCTTGTGCTTTTACTGTTCAAATGTGCTTTTCAAAACTTGCTTGTATATACACCAAAAAATAAGCACTTTTTATGCTCACAGTTTGGATT[T/C]
GGTAAGTTGATGATTTATAGTTGGCTTTGCATGAAGTTAGTAGTCTCCTTGGAGACAAGCCAACAAATATTTAAATCCTACCCAAGCTGGAAACCATATC

Reverse complement sequence

GATATGGTTTCCAGCTTGGGTAGGATTTAAATATTTGTTGGCTTGTCTCCAAGGAGACTACTAACTTCATGCAAAGCCAACTATAAATCATCAACTTACC[A/G]
AATCCAAACTGTGAGCATAAAAAGTGCTTATTTTTTGGTGTATATACAAGCAAGTTTTGAAAAGCACATTTGAACAGTAAAAGCACAAGCAACACCTTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 9.20% 0.78% 0.00% NA
All Indica  2759 99.70% 0.20% 0.04% 0.00% NA
All Japonica  1512 69.60% 28.00% 2.38% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 46.30% 49.30% 4.43% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 82.20% 17.00% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218567229 T -> C LOC_Os02g31074.1 downstream_gene_variant ; 2536.0bp to feature; MODIFIER silent_mutation Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg0218567229 T -> C LOC_Os02g31070.1 intron_variant ; MODIFIER silent_mutation Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg0218567229 T -> C LOC_Os02g31070.2 intron_variant ; MODIFIER silent_mutation Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg0218567229 T -> C LOC_Os02g31070.4 intron_variant ; MODIFIER silent_mutation Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg0218567229 T -> C LOC_Os02g31070.3 intron_variant ; MODIFIER silent_mutation Average:64.037; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218567229 NA 5.19E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0218567229 4.86E-06 NA mr1609 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218567229 6.62E-07 6.62E-07 mr1609 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218567229 NA 1.16E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218567229 NA 1.96E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218567229 NA 2.65E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218567229 NA 1.77E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251