\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218382286:

Variant ID: vg0218382286 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18382286
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGACGAATCTTTTGAGCCTAATTAGTCTATGATTAGCCATAAGTGCTACAGTAACCTACATGTGCTAATGACGGATTAATTAGTCTCAAAAGATTCAT[T/C]
TCGTGGTTTTCAAGCGAGTTATGAAATTAGTTTTTTCATTCGTGTCCAAAAACCCCTTCCGACATCCGATCAAACGTTTGATGTGACACCTAAAAATTAT

Reverse complement sequence

ATAATTTTTAGGTGTCACATCAAACGTTTGATCGGATGTCGGAAGGGGTTTTTGGACACGAATGAAAAAACTAATTTCATAACTCGCTTGAAAACCACGA[A/G]
ATGAATCTTTTGAGACTAATTAATCCGTCATTAGCACATGTAGGTTACTGTAGCACTTATGGCTAATCATAGACTAATTAGGCTCAAAAGATTCGTCTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 5.50% 1.97% 0.00% NA
All Indica  2759 99.90% 0.10% 0.04% 0.00% NA
All Japonica  1512 77.40% 16.50% 6.08% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 58.10% 30.80% 11.08% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 91.70% 5.40% 2.90% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218382286 T -> C LOC_Os02g30820.1 upstream_gene_variant ; 3666.0bp to feature; MODIFIER silent_mutation Average:78.532; most accessible tissue: Zhenshan97 panicle, score: 95.855 N N N N
vg0218382286 T -> C LOC_Os02g30830.1 upstream_gene_variant ; 1157.0bp to feature; MODIFIER silent_mutation Average:78.532; most accessible tissue: Zhenshan97 panicle, score: 95.855 N N N N
vg0218382286 T -> C LOC_Os02g30840.1 upstream_gene_variant ; 2920.0bp to feature; MODIFIER silent_mutation Average:78.532; most accessible tissue: Zhenshan97 panicle, score: 95.855 N N N N
vg0218382286 T -> C LOC_Os02g30840.2 upstream_gene_variant ; 2920.0bp to feature; MODIFIER silent_mutation Average:78.532; most accessible tissue: Zhenshan97 panicle, score: 95.855 N N N N
vg0218382286 T -> C LOC_Os02g30830-LOC_Os02g30840 intergenic_region ; MODIFIER silent_mutation Average:78.532; most accessible tissue: Zhenshan97 panicle, score: 95.855 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0218382286 T C 0.08 0.05 0.02 0.04 0.06 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218382286 NA 8.65E-13 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0218382286 NA 4.00E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0218382286 NA 3.30E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218382286 1.19E-07 4.67E-08 mr1354 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218382286 NA 4.31E-10 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218382286 4.42E-07 7.63E-11 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218382286 NA 3.27E-08 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218382286 NA 9.59E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218382286 8.49E-11 1.88E-10 mr1354_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218382286 2.86E-08 5.60E-14 mr1354_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218382286 9.24E-06 9.91E-12 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218382286 NA 3.43E-07 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218382286 3.03E-07 3.85E-17 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218382286 NA 5.37E-09 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251